MD11G1139600.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0021162
Physical Location & Seq
Reverse (-)
12908151 .. 12908723
573 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1139600.v1.1.491

Sequence Viewer

Length: 159 bp
ATGGATCCGCCGCCACCAAGCACGCCGCTCCTAGCCACCGCTCCTCCTCCCTATCACCAACCAGGATGCTTGGAATTCTGCTTGTGGATTCTATGCTGCTGCGGTATATTTAAATGCTGCTGCCCTCCACTGTTTGAGCCTGGGCCGCCTCCACCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.59

Weight (kDa)

4.65

Isoelectric Point (pI)

75.18

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021162)

Species Orthologous Gene IDs
malus_domestica MD03G1120800.v1.1 MD11G1139600.v1.1
prunus_persica Prupe.6G104300_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0058491
rosa_samantha Rh5BG393300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 2 cut(s) 28, 41
AciI CCGC 6 cut(s) 8, 11, 26, 39, 102, 146
AclWI GGATC 1 cut(s) 12
AcsI RAATTY 1 cut(s) 74
AjnI CCWGG 2 cut(s) 61, 139
AlwI GGATC 1 cut(s) 12
AoxI GGCC 1 cut(s) 143
ApeKI GCWGC 4 cut(s) 96, 99, 117, 120
ApoI RAATTY 1 cut(s) 74
AspS9I GGNCC 1 cut(s) 143
AsuHPI GGTGA 1 cut(s) 47
BamHI GGATCC 1 cut(s) 4
BbvI GCAGC 4 cut(s) 83, 86, 104, 107
BciT130I CCWGG 2 cut(s) 63, 141
BfaI CTAG 1 cut(s) 32
BisI GCNGC 7 cut(s) 11, 26, 97, 100, 118, 121, 146
BlsI GCNGC 7 cut(s) 12, 27, 98, 101, 119, 122, 147
Bme1390I CCNGG 2 cut(s) 63, 141
BmgT120I GGNCC 1 cut(s) 143
BmiI GGNNCC 1 cut(s) 6
BmrFI CCNGG 2 cut(s) 63, 141
BmsI GCATC 1 cut(s) 56
BsaJI CCNNGG 1 cut(s) 140
BsaXI ACNNNNNCTCC 2 cut(s) 28, 58
BseBI CCWGG 2 cut(s) 63, 141
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 1 cut(s) 71
BseRI GAGGAG 2 cut(s) 33, 36
BseXI GCAGC 4 cut(s) 83, 86, 104, 107
BshFI GGCC 1 cut(s) 145
BsnI GGCC 1 cut(s) 145
Bsp143I GATC 1 cut(s) 4
BspACI CCGC 6 cut(s) 8, 11, 26, 39, 102, 146
BspANI GGCC 1 cut(s) 145
BspLI GGNNCC 1 cut(s) 6
BspPI GGATC 1 cut(s) 12
BsrBI CCGCTC 2 cut(s) 28, 41
BssECI CCNNGG 1 cut(s) 140
BssMI GATC 1 cut(s) 4
Bst2UI CCWGG 2 cut(s) 63, 141
Bst4CI ACNGT 1 cut(s) 132
BstC8I GCNNGC 1 cut(s) 23
BstF5I GGATG 1 cut(s) 71
BstKTI GATC 1 cut(s) 7
BstMBI GATC 1 cut(s) 4
BstMWI GCNNNNNNNGC 1 cut(s) 145
BstNI CCWGG 2 cut(s) 63, 141
BstSCI CCNGG 2 cut(s) 61, 139
BstV1I GCAGC 4 cut(s) 83, 86, 104, 107
BstX2I RGATCY 1 cut(s) 4
BstYI RGATCY 1 cut(s) 4
BsuRI GGCC 1 cut(s) 145
BtsCI GGATG 1 cut(s) 71
BtsIMutI CAGTG 1 cut(s) 128
Cac8I GCNNGC 1 cut(s) 23
Cfr13I GGNCC 1 cut(s) 143
CviJI RGCY 3 cut(s) 35, 139, 145
CviKI_1 RGCY 3 cut(s) 35, 139, 145
DpnI GATC 1 cut(s) 6
DpnII GATC 1 cut(s) 4
DraI TTTAAA 1 cut(s) 112
EcoRI GAATTC 1 cut(s) 74
EcoRII CCWGG 2 cut(s) 61, 139
FaiI YATR 3 cut(s) 94, 107, 157
Fnu4HI GCNGC 7 cut(s) 11, 26, 97, 100, 118, 121, 146
FokI GGATG 1 cut(s) 78
Fsp4HI GCNGC 7 cut(s) 11, 26, 97, 100, 118, 121, 146
FspBI CTAG 1 cut(s) 32
GluI GCNGC 7 cut(s) 11, 26, 97, 100, 118, 121, 146
HaeIII GGCC 1 cut(s) 145
HinfI GANTC 1 cut(s) 88
HphI GGTGA 1 cut(s) 47
HpyCH4III ACNGT 1 cut(s) 132
HpyF10VI GCNNNNNNNGC 1 cut(s) 145
Kzo9I GATC 1 cut(s) 4
LmnI GCTCC 2 cut(s) 33, 46
LpnPI CCDG 4 cut(s) 48, 75, 126, 153
Lsp1109I GCAGC 4 cut(s) 83, 86, 104, 107
LweI GCATC 1 cut(s) 56
MaeI CTAG 1 cut(s) 32
MalI GATC 1 cut(s) 6
MbiI CCGCTC 2 cut(s) 28, 41
MboI GATC 1 cut(s) 4
MflI RGATCY 1 cut(s) 4
MluCI AATT 1 cut(s) 74
MnlI CCTC 4 cut(s) 54, 57, 135, 159
MseI TTAA 1 cut(s) 111
MspR9I CCNGG 2 cut(s) 63, 141
MvaI CCWGG 2 cut(s) 63, 141
MwoI GCNNNNNNNGC 1 cut(s) 145
NdeII GATC 1 cut(s) 4
NlaIV GGNNCC 1 cut(s) 6
PfeI GAWTC 1 cut(s) 88
PkrI GCNGC 7 cut(s) 12, 27, 98, 101, 119, 122, 147
Psp6I CCWGG 2 cut(s) 61, 139
PspGI CCWGG 2 cut(s) 61, 139
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 1 cut(s) 143
PsuI RGATCY 1 cut(s) 4
SaqAI TTAA 1 cut(s) 111
SatI GCNGC 7 cut(s) 11, 26, 97, 100, 118, 121, 146
Sau3AI GATC 1 cut(s) 4
Sau96I GGNCC 1 cut(s) 143
ScrFI CCNGG 2 cut(s) 63, 141
SfaNI GCATC 1 cut(s) 56
SgeI CNNG 9 cut(s) 30, 34, 44, 74, 75, 82, 94, 152, 153
SmiI ATTTAAAT 1 cut(s) 112
Sse9I AATT 1 cut(s) 74
SsiI CCGC 6 cut(s) 8, 11, 26, 39, 102, 146
SspMI CTAG 1 cut(s) 32
StyD4I CCNGG 2 cut(s) 61, 139
SwaI ATTTAAAT 1 cut(s) 112
TaaI ACNGT 1 cut(s) 132
TasI AATT 1 cut(s) 74
TauI GCSGC 3 cut(s) 13, 28, 148
TfiI GAWTC 1 cut(s) 88
Tru1I TTAA 1 cut(s) 111
Tru9I TTAA 1 cut(s) 111
TscAI CASTG 1 cut(s) 135
TseI GCWGC 4 cut(s) 96, 99, 117, 120
TspRI CASTG 1 cut(s) 135
XapI RAATTY 1 cut(s) 74
XspI CTAG 1 cut(s) 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.