Rh5BG393300

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5B
Physical Location & Seq
Forward (+)
63268659 .. 63275115
6457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5BG393300.1

Sequence Viewer

Length: 165 bp
ATGCCGGAGCTGGATCCACCGCCTCCTGGCACACCGCTGCTGGCCCCGGCTCCTCCCTACCATCGAGGAGGATGCTTGGAACTATGGCAAGTACTTCCAGATCGAGTTGTAGATGAGCAAAATGGAAAAAACAGCCAGACTAGAAGAATCTATATGAATAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.08

Weight (kDa)

5.56

Isoelectric Point (pI)

73.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021162)

Species Orthologous Gene IDs
malus_domestica MD03G1120800.v1.1 MD11G1139600.v1.1
prunus_persica Prupe.6G104300_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0058491
rosa_samantha Rh5BG393300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 20, 35
AclWI GGATC 2 cut(s) 8, 21
AfaI GTAC 1 cut(s) 93
AfiI CCNNNNNNNGG 1 cut(s) 26
AjnI CCWGG 1 cut(s) 25
AluBI AGCT 1 cut(s) 10
AluI AGCT 1 cut(s) 10
AlwI GGATC 2 cut(s) 8, 21
AoxI GGCC 1 cut(s) 42
ApeKI GCWGC 1 cut(s) 37
AspS9I GGNCC 1 cut(s) 43
AsuC2I CCSGG 1 cut(s) 47
BamHI GGATCC 1 cut(s) 13
BbvI GCAGC 1 cut(s) 24
BccI CCATC 1 cut(s) 69
BcgI CGANNNNNNTGC 2 cut(s) 54, 88
BciT130I CCWGG 1 cut(s) 27
BcnI CCSGG 1 cut(s) 47
BfaI CTAG 1 cut(s) 141
BisI GCNGC 1 cut(s) 38
BlsI GCNGC 1 cut(s) 39
BmcAI AGTACT 1 cut(s) 93
Bme1390I CCNGG 2 cut(s) 27, 47
BmgT120I GGNCC 1 cut(s) 43
BmiI GGNNCC 3 cut(s) 15, 45, 51
BmrFI CCNGG 2 cut(s) 27, 47
BmsI GCATC 1 cut(s) 62
BpuMI CCSGG 1 cut(s) 47
BsaJI CCNNGG 1 cut(s) 45
Bsc4I CCNNNNNNNGG 1 cut(s) 26
BseBI CCWGG 1 cut(s) 27
BseDI CCNNGG 1 cut(s) 45
BseGI GGATG 1 cut(s) 77
BseLI CCNNNNNNNGG 1 cut(s) 26
BseRI GAGGAG 2 cut(s) 42, 81
BseXI GCAGC 1 cut(s) 24
BshFI GGCC 1 cut(s) 44
BsiSI CCGG 2 cut(s) 5, 47
BslI CCNNNNNNNGG 1 cut(s) 26
BsnI GGCC 1 cut(s) 44
Bsp143I GATC 2 cut(s) 13, 100
BspACI CCGC 2 cut(s) 20, 35
BspANI GGCC 1 cut(s) 44
BspLI GGNNCC 3 cut(s) 15, 45, 51
BspPI GGATC 2 cut(s) 8, 21
BssECI CCNNGG 1 cut(s) 45
BssMI GATC 2 cut(s) 13, 100
Bst2UI CCWGG 1 cut(s) 27
BstC8I GCNNGC 1 cut(s) 42
BstF5I GGATG 1 cut(s) 77
BstKTI GATC 2 cut(s) 16, 103
BstMBI GATC 2 cut(s) 13, 100
BstNI CCWGG 1 cut(s) 27
BstSCI CCNGG 2 cut(s) 25, 45
BstV1I GCAGC 1 cut(s) 24
BstX2I RGATCY 1 cut(s) 13
BstYI RGATCY 1 cut(s) 13
BsuRI GGCC 1 cut(s) 44
BtsCI GGATG 1 cut(s) 77
Cac8I GCNNGC 1 cut(s) 42
Cfr13I GGNCC 1 cut(s) 43
Csp6I GTAC 1 cut(s) 92
CviJI RGCY 4 cut(s) 10, 44, 50, 135
CviKI_1 RGCY 4 cut(s) 10, 44, 50, 135
CviQI GTAC 1 cut(s) 92
DpnI GATC 2 cut(s) 15, 102
DpnII GATC 2 cut(s) 13, 100
EcoRII CCWGG 1 cut(s) 25
FaiI YATR 3 cut(s) 85, 153, 155
Fnu4HI GCNGC 1 cut(s) 38
FokI GGATG 1 cut(s) 84
Fsp4HI GCNGC 1 cut(s) 38
FspBI CTAG 1 cut(s) 141
GluI GCNGC 1 cut(s) 38
HaeIII GGCC 1 cut(s) 44
HapII CCGG 2 cut(s) 5, 47
HinfI GANTC 1 cut(s) 147
HpaII CCGG 2 cut(s) 5, 47
Hpy188III TCNNGA 1 cut(s) 98
Kzo9I GATC 2 cut(s) 13, 100
LmnI GCTCC 2 cut(s) 7, 55
LpnPI CCDG 7 cut(s) 12, 18, 26, 39, 60, 111, 149
Lsp1109I GCAGC 1 cut(s) 24
LweI GCATC 1 cut(s) 62
MaeI CTAG 1 cut(s) 141
MalI GATC 2 cut(s) 15, 102
MboI GATC 2 cut(s) 13, 100
MboII GAAGA 1 cut(s) 156
MflI RGATCY 1 cut(s) 13
MluCI AATT 1 cut(s) 160
MnlI CCTC 4 cut(s) 33, 59, 62, 63
MseI TTAA 1 cut(s) 163
MspA1I CMGCKG 1 cut(s) 37
MspI CCGG 2 cut(s) 5, 47
MspR9I CCNGG 2 cut(s) 27, 47
MvaI CCWGG 1 cut(s) 27
NciI CCSGG 1 cut(s) 47
NdeII GATC 2 cut(s) 13, 100
NlaIV GGNNCC 3 cut(s) 15, 45, 51
PfeI GAWTC 1 cut(s) 147
PkrI GCNGC 1 cut(s) 39
Psp6I CCWGG 1 cut(s) 25
PspGI CCWGG 1 cut(s) 25
PspN4I GGNNCC 3 cut(s) 15, 45, 51
PspPI GGNCC 1 cut(s) 43
PsuI RGATCY 1 cut(s) 13
RsaI GTAC 1 cut(s) 93
RsaNI GTAC 1 cut(s) 92
SaqAI TTAA 1 cut(s) 163
SatI GCNGC 1 cut(s) 38
Sau3AI GATC 2 cut(s) 13, 100
Sau96I GGNCC 1 cut(s) 43
ScaI AGTACT 1 cut(s) 93
ScrFI CCNGG 2 cut(s) 27, 47
SetI ASST 1 cut(s) 12
SfaNI GCATC 1 cut(s) 62
Sse9I AATT 1 cut(s) 160
SsiI CCGC 2 cut(s) 20, 35
SspMI CTAG 1 cut(s) 141
StyD4I CCNGG 2 cut(s) 25, 45
TaqI TCGA 2 cut(s) 64, 103
TasI AATT 1 cut(s) 160
TatI WGTACW 1 cut(s) 91
TfiI GAWTC 1 cut(s) 147
Tru1I TTAA 1 cut(s) 163
Tru9I TTAA 1 cut(s) 163
TseI GCWGC 1 cut(s) 37
XspI CTAG 1 cut(s) 141
ZrmI AGTACT 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.