MD04G1055000.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Forward (+)
6588329 .. 6592276
3948 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1055000.v1.1.491

Sequence Viewer

Length: 192 bp
ATGAAAGTCATAATTCCTTGGCACTTGCACAATTCGTGGTATAGATGGGAGACAAAACCCTTGCGGGTGTCTACACCTCTGAAACTCAGAAACACGTCATACTTCCATCGAGGACTGATTCAAATGAAAGAAAGAGATGCAGAGGCCCTTTGCGTGCAAAACGCTAATGCAAAGTGGCTCCTAACAATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.6

Weight (kDa)

10.13

Isoelectric Point (pI)

23.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020363)

Species Orthologous Gene IDs
malus_domestica MD04G1055000.v1.1 MD09G1251400.v1.1
pyrus_communis pycom111g02010
rosa_chinensis RchiOBHm_Chr1g0365631 RchiOBHm_Chr5g0039661
rosa_multiflora Rmu_sc0002587.1_g000045

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 71
AciI CCGC 1 cut(s) 64
AflIII ACRYGT 1 cut(s) 93
AgsI TTSAA 1 cut(s) 122
AjiI CACGTC 1 cut(s) 96
Alw26I GTCTC 1 cut(s) 44
AoxI GGCC 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 145
BccI CCATC 2 cut(s) 39, 114
BcoDI GTCTC 1 cut(s) 44
BmgBI CACGTC 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 145
BmiI GGNNCC 1 cut(s) 179
BmsI GCATC 1 cut(s) 127
BsaJI CCNNGG 1 cut(s) 17
BseDI CCNNGG 1 cut(s) 17
BseMII CTCAG 1 cut(s) 100
BshFI GGCC 1 cut(s) 146
BsmAI GTCTC 1 cut(s) 44
BsnI GGCC 1 cut(s) 146
BspACI CCGC 1 cut(s) 64
BspANI GGCC 1 cut(s) 146
BspCNI CTCAG 1 cut(s) 99
BspLI GGNNCC 1 cut(s) 179
BssECI CCNNGG 1 cut(s) 17
BssT1I CCWWGG 1 cut(s) 17
BstC8I GCNNGC 1 cut(s) 155
BstDEI CTNAG 1 cut(s) 86
BstMAI GTCTC 1 cut(s) 44
BsuRI GGCC 1 cut(s) 146
BtrI CACGTC 1 cut(s) 96
Cac8I GCNNGC 1 cut(s) 155
Cfr13I GGNCC 1 cut(s) 145
CviJI RGCY 2 cut(s) 146, 178
CviKI_1 RGCY 2 cut(s) 146, 178
DdeI CTNAG 1 cut(s) 86
Eco130I CCWWGG 1 cut(s) 17
EcoO109I RGGNCCY 1 cut(s) 145
EcoT14I CCWWGG 1 cut(s) 17
ErhI CCWWGG 1 cut(s) 17
FaiI YATR 3 cut(s) 11, 42, 100
FauI CCCGC 1 cut(s) 57
FblI GTMKAC 1 cut(s) 71
HaeIII GGCC 1 cut(s) 146
HinfI GANTC 1 cut(s) 118
Hpy166II GTNNAC 1 cut(s) 72
Hpy188I TCNGA 3 cut(s) 81, 89, 191
Hpy8I GTNNAC 1 cut(s) 72
HpyCH4IV ACGT 1 cut(s) 95
HpyCH4V TGCA 4 cut(s) 28, 140, 157, 170
HpyF3I CTNAG 1 cut(s) 86
HpySE526I ACGT 1 cut(s) 95
LmnI GCTCC 1 cut(s) 183
LweI GCATC 1 cut(s) 127
MaeII ACGT 1 cut(s) 95
MluCI AATT 2 cut(s) 12, 31
MnlI CCTC 3 cut(s) 87, 104, 136
NlaIV GGNNCC 1 cut(s) 179
PfeI GAWTC 1 cut(s) 118
PspN4I GGNNCC 1 cut(s) 179
PspPI GGNCC 1 cut(s) 145
Sau96I GGNCC 1 cut(s) 145
SetI ASST 2 cut(s) 79, 98
SfaNI GCATC 1 cut(s) 127
SgeI CNNG 8 cut(s) 30, 37, 48, 73, 77, 106, 122, 166
Sse9I AATT 2 cut(s) 12, 31
SsiI CCGC 1 cut(s) 64
StyI CCWWGG 1 cut(s) 17
TaiI ACGT 1 cut(s) 98
TaqI TCGA 1 cut(s) 109
TasI AATT 2 cut(s) 12, 31
TfiI GAWTC 1 cut(s) 118
TspDTI ATGAA 2 cut(s) 17, 140
XmiI GTMKAC 1 cut(s) 71
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.