MD04G1132800.v1.1

High-light-induced protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
21954188 .. 21955991
1804 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1132800.v1.1.491

Sequence Viewer

Length: 336 bp
ATGGCAACTTCATGTACCATACTTTCATCTTCTCTCCTCCCCACTAGGGTTCTAACAGCAAATCCTCAAACCCAGCAACTCCACCCAGTTCCCAGGAGGCGTCCCAGCTCCTTCAGAGTTCAAGCTGCCAAACTTCCTGCTGGGGTGGTGGTGCCAAAAGTAGAGCCAAAACTTAAGGCCCCTTTAGCTGGATTCACCAGGACTGCAGAAATATGGAATTCTAGAGCTTGTATGATTGGACTTATCGGAACCTTCATTGTGGAACTGATATTGAACAAGGGAATACTGCAGTTGATCGGAGTGGAGATTGGAAAAGGCCTTGATATTCCTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

11.94

Weight (kDa)

10.6

Isoelectric Point (pI)

68.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013492)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 151
AcsI RAATTY 1 cut(s) 217
AcuI CTGAAG 1 cut(s) 97
AcyI GRCGYC 1 cut(s) 100
AfaI GTAC 1 cut(s) 16
AfiI CCNNNNNNNGG 2 cut(s) 46, 188
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 2 cut(s) 122, 274
AjnI CCWGG 2 cut(s) 92, 197
AluBI AGCT 4 cut(s) 108, 125, 188, 227
AluI AGCT 4 cut(s) 108, 125, 188, 227
AoxI GGCC 2 cut(s) 177, 316
ApeKI GCWGC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 217
AspS9I GGNCC 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 187
BanI GGYRCC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 112
BciT130I CCWGG 2 cut(s) 94, 199
BfaI CTAG 2 cut(s) 45, 222
BfmI CTRYAG 2 cut(s) 204, 287
BfrI CTTAAG 1 cut(s) 173
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
Bme1390I CCNGG 2 cut(s) 94, 199
BmgT120I GGNCC 1 cut(s) 178
BmiI GGNNCC 3 cut(s) 153, 180, 250
BmrFI CCNGG 2 cut(s) 94, 199
BmrI ACTGGG 1 cut(s) 80
BmuI ACTGGG 1 cut(s) 80
BsaHI GRCGYC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 188
Bse1I ACTGG 1 cut(s) 86
BseBI CCWGG 2 cut(s) 94, 199
BseDI CCNNGG 1 cut(s) 92
BseLI CCNNNNNNNGG 2 cut(s) 46, 188
BseNI ACTGG 1 cut(s) 86
BseRI GAGGAG 1 cut(s) 26
BseXI GCAGC 1 cut(s) 112
BseYI CCCAGC 3 cut(s) 72, 104, 140
BshFI GGCC 2 cut(s) 179, 318
BshNI GGYRCC 1 cut(s) 151
BslFI GGGAC 1 cut(s) 87
BslI CCNNNNNNNGG 2 cut(s) 46, 188
BsmFI GGGAC 1 cut(s) 87
BsnI GGCC 2 cut(s) 179, 318
Bsp143I GATC 1 cut(s) 294
BspANI GGCC 2 cut(s) 179, 318
BspLI GGNNCC 3 cut(s) 153, 180, 250
BspMAI CTGCAG 2 cut(s) 208, 291
BspT107I GGYRCC 1 cut(s) 151
BspTI CTTAAG 1 cut(s) 173
BsrI ACTGG 1 cut(s) 86
BssECI CCNNGG 1 cut(s) 92
BssMI GATC 1 cut(s) 294
BssNI GRCGYC 1 cut(s) 100
Bst2UI CCWGG 2 cut(s) 94, 199
BstACI GRCGYC 1 cut(s) 100
BstAFI CTTAAG 1 cut(s) 173
BstKTI GATC 1 cut(s) 297
BstMBI GATC 1 cut(s) 294
BstMWI GCNNNNNNNGC 1 cut(s) 185
BstNI CCWGG 2 cut(s) 94, 199
BstSCI CCNGG 2 cut(s) 92, 197
BstSFI CTRYAG 2 cut(s) 204, 287
BstV1I GCAGC 1 cut(s) 112
BsuRI GGCC 2 cut(s) 179, 318
Cfr13I GGNCC 1 cut(s) 178
CseI GACGC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 15
CviAII CATG 1 cut(s) 12
CviJI RGCY 7 cut(s) 108, 125, 166, 179, 188, 227, 318
CviKI_1 RGCY 7 cut(s) 108, 125, 166, 179, 188, 227, 318
CviQI GTAC 1 cut(s) 15
DpnI GATC 1 cut(s) 296
DpnII GATC 1 cut(s) 294
Eco147I AGGCCT 1 cut(s) 318
Eco57I CTGAAG 1 cut(s) 97
EcoO109I RGGNCCY 1 cut(s) 178
EcoRI GAATTC 1 cut(s) 217
EcoRII CCWGG 2 cut(s) 92, 197
FaeI CATG 1 cut(s) 15
FaiI YATR 4 cut(s) 13, 20, 214, 233
FaqI GGGAC 1 cut(s) 87
FatI CATG 1 cut(s) 11
Fnu4HI GCNGC 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 126
FspBI CTAG 2 cut(s) 45, 222
GluI GCNGC 1 cut(s) 126
GsaI CCCAGC 3 cut(s) 76, 108, 144
HaeIII GGCC 2 cut(s) 179, 318
HgaI GACGC 1 cut(s) 89
Hin1I GRCGYC 1 cut(s) 100
Hin1II CATG 1 cut(s) 15
HinfI GANTC 1 cut(s) 192
HphI GGTGA 1 cut(s) 187
Hpy188I TCNGA 3 cut(s) 116, 248, 299
Hpy188III TCNNGA 1 cut(s) 222
HpyAV CCTTC 2 cut(s) 121, 262
HpyCH4V TGCA 2 cut(s) 206, 289
HpyF10VI GCNNNNNNNGC 1 cut(s) 185
Hsp92I GRCGYC 1 cut(s) 100
Hsp92II CATG 1 cut(s) 15
Kzo9I GATC 1 cut(s) 294
LmnI GCTCC 1 cut(s) 113
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 2 cut(s) 45, 222
MalI GATC 1 cut(s) 296
MboI GATC 1 cut(s) 294
MboII GAAGA 1 cut(s) 21
MluCI AATT 1 cut(s) 217
MnlI CCTC 3 cut(s) 47, 75, 90
MseI TTAA 1 cut(s) 174
MspCI CTTAAG 1 cut(s) 173
MspR9I CCNGG 2 cut(s) 94, 199
MvaI CCWGG 2 cut(s) 94, 199
MwoI GCNNNNNNNGC 1 cut(s) 185
NdeII GATC 1 cut(s) 294
NlaIII CATG 1 cut(s) 15
NlaIV GGNNCC 3 cut(s) 153, 180, 250
PceI AGGCCT 1 cut(s) 318
PfeI GAWTC 1 cut(s) 192
PkrI GCNGC 1 cut(s) 127
Psp6I CCWGG 2 cut(s) 92, 197
PspFI CCCAGC 3 cut(s) 72, 104, 140
PspGI CCWGG 2 cut(s) 92, 197
PspN4I GGNNCC 3 cut(s) 153, 180, 250
PspPI GGNCC 1 cut(s) 178
PstI CTGCAG 2 cut(s) 208, 291
RsaI GTAC 1 cut(s) 16
RsaNI GTAC 1 cut(s) 15
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 126
Sau3AI GATC 1 cut(s) 294
Sau96I GGNCC 1 cut(s) 178
ScrFI CCNGG 2 cut(s) 94, 199
SetI ASST 5 cut(s) 110, 127, 190, 229, 254
SfcI CTRYAG 2 cut(s) 204, 287
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 1 cut(s) 217
SseBI AGGCCT 1 cut(s) 318
SspMI CTAG 2 cut(s) 45, 222
StuI AGGCCT 1 cut(s) 318
StyD4I CCNGG 2 cut(s) 92, 197
TasI AATT 1 cut(s) 217
TfiI GAWTC 1 cut(s) 192
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 1 cut(s) 125
TspDTI ATGAA 2 cut(s) 15, 244
Vha464I CTTAAG 1 cut(s) 173
XapI RAATTY 1 cut(s) 217
XbaI TCTAGA 1 cut(s) 221
XspI CTAG 2 cut(s) 45, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.