pycom04g12070

High-light-induced protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr4
OG0013492
Physical Location & Seq
Reverse (-)
15023836 .. 15024598
763 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom04g12070.1

Sequence Viewer

Length: 336 bp
ATGGCAACTTCTTCTACCGTACTTTCGTCTTCTCTCCTCCCCACTAGGGTTCTAACAGCAAATCCGCAAACCCAGCAATTCCACCCAGCTCCCAGGAGGCGTCCCAGCTCCTTCAGAGTTCAAGCTGCCAAACTTCCTGCTGGGGTGGTGGTGCCAAAAATAGAGCCAAAACTTAAGGCCCCTTTTGCTGGATTCACCAGGACTGCAGAAATATGGAATTCTAGAGCTTGTATGATTGGACTTATTGGAACCTTCATTGTGGAACTGATATTGAACAAGGGAATACTGCAGCTGATCGGAGTGGAGATCGGAAAGGGCCTTGATATTCCTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

11.96

Weight (kDa)

10.97

Isoelectric Point (pI)

67.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0013492)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G02120
fragaria_vesca FvH4_6g13240
malus_domestica MD04G1132800.v1.1 MD12G1145500.v1.1
prunus_persica Prupe.6G259200_v2.0.a1 Prupe.6G259200_v2.0.a1
pyrus_communis pycom04g12070
rosa_chinensis RchiOBHm_Chr3g0466071
rosa_laevigata RLG00000024605
rosa_multiflora Rmu_sc0005135.1_g000004 Rmu_sc0007597.1_g000005 Rmu_sc0029260.1_g000003
rosa_roxburghii Rroxscaffold_6G00414820
rosa_rugosa Rorug03G0079300
rosa_samantha Rh3BG146700 Rh3CG147400 Rh3DG147500
rosa_wichuraiana Rw3G011840

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 151
AciI CCGC 1 cut(s) 65
AcsI RAATTY 1 cut(s) 217
AcuI CTGAAG 1 cut(s) 97
AcyI GRCGYC 1 cut(s) 100
AfaI GTAC 1 cut(s) 21
AfiI CCNNNNNNNGG 2 cut(s) 46, 188
AflII CTTAAG 1 cut(s) 173
AgsI TTSAA 2 cut(s) 122, 274
AjnI CCWGG 2 cut(s) 92, 197
AluBI AGCT 5 cut(s) 89, 108, 125, 227, 292
AluI AGCT 5 cut(s) 89, 108, 125, 227, 292
AoxI GGCC 2 cut(s) 177, 316
ApeKI GCWGC 2 cut(s) 125, 289
ApoI RAATTY 1 cut(s) 217
AspS9I GGNCC 2 cut(s) 178, 316
AsuHPI GGTGA 1 cut(s) 187
BanI GGYRCC 1 cut(s) 151
BbsI GAAGAC 1 cut(s) 21
BbvI GCAGC 2 cut(s) 112, 301
BciT130I CCWGG 2 cut(s) 94, 199
BfaI CTAG 2 cut(s) 45, 222
BfmI CTRYAG 2 cut(s) 204, 287
BfrI CTTAAG 1 cut(s) 173
BisI GCNGC 2 cut(s) 126, 290
BlsI GCNGC 2 cut(s) 127, 291
Bme1390I CCNGG 2 cut(s) 94, 199
BmgT120I GGNCC 2 cut(s) 178, 316
BmiI GGNNCC 3 cut(s) 153, 180, 250
BmrFI CCNGG 2 cut(s) 94, 199
BpiI GAAGAC 1 cut(s) 21
BsaHI GRCGYC 1 cut(s) 100
BsaJI CCNNGG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 188
BseBI CCWGG 2 cut(s) 94, 199
BseDI CCNNGG 1 cut(s) 92
BseLI CCNNNNNNNGG 2 cut(s) 46, 188
BseRI GAGGAG 1 cut(s) 26
BseXI GCAGC 2 cut(s) 112, 301
BseYI CCCAGC 4 cut(s) 72, 85, 104, 140
BshFI GGCC 2 cut(s) 179, 318
BshNI GGYRCC 1 cut(s) 151
BslFI GGGAC 1 cut(s) 87
BslI CCNNNNNNNGG 2 cut(s) 46, 188
BsmFI GGGAC 1 cut(s) 87
BsnI GGCC 2 cut(s) 179, 318
Bsp143I GATC 2 cut(s) 294, 306
BspACI CCGC 1 cut(s) 65
BspANI GGCC 2 cut(s) 179, 318
BspLI GGNNCC 3 cut(s) 153, 180, 250
BspMAI CTGCAG 2 cut(s) 208, 291
BspT107I GGYRCC 1 cut(s) 151
BspTI CTTAAG 1 cut(s) 173
BssECI CCNNGG 1 cut(s) 92
BssMI GATC 2 cut(s) 294, 306
BssNI GRCGYC 1 cut(s) 100
Bst2UI CCWGG 2 cut(s) 94, 199
Bst4CI ACNGT 1 cut(s) 19
BstACI GRCGYC 1 cut(s) 100
BstAFI CTTAAG 1 cut(s) 173
BstKTI GATC 2 cut(s) 297, 309
BstMBI GATC 2 cut(s) 294, 306
BstMWI GCNNNNNNNGC 2 cut(s) 73, 185
BstNI CCWGG 2 cut(s) 94, 199
BstSCI CCNGG 2 cut(s) 92, 197
BstSFI CTRYAG 2 cut(s) 204, 287
BstV1I GCAGC 2 cut(s) 112, 301
BstV2I GAAGAC 1 cut(s) 21
BsuRI GGCC 2 cut(s) 179, 318
Cfr13I GGNCC 2 cut(s) 178, 316
CseI GACGC 1 cut(s) 89
Csp6I GTAC 1 cut(s) 20
CviJI RGCY 8 cut(s) 89, 108, 125, 166, 179, 227, 292, 318
CviKI_1 RGCY 8 cut(s) 89, 108, 125, 166, 179, 227, 292, 318
CviQI GTAC 1 cut(s) 20
DpnI GATC 2 cut(s) 296, 308
DpnII GATC 2 cut(s) 294, 306
Eco57I CTGAAG 1 cut(s) 97
EcoO109I RGGNCCY 2 cut(s) 178, 316
EcoRI GAATTC 1 cut(s) 217
EcoRII CCWGG 2 cut(s) 92, 197
FaiI YATR 2 cut(s) 214, 233
FaqI GGGAC 1 cut(s) 87
Fnu4HI GCNGC 2 cut(s) 126, 290
Fsp4HI GCNGC 2 cut(s) 126, 290
FspBI CTAG 2 cut(s) 45, 222
GluI GCNGC 2 cut(s) 126, 290
GsaI CCCAGC 4 cut(s) 76, 89, 108, 144
HaeIII GGCC 2 cut(s) 179, 318
HgaI GACGC 1 cut(s) 89
Hin1I GRCGYC 1 cut(s) 100
HinfI GANTC 1 cut(s) 192
HphI GGTGA 1 cut(s) 187
Hpy188I TCNGA 3 cut(s) 116, 299, 311
Hpy188III TCNNGA 1 cut(s) 222
HpyAV CCTTC 2 cut(s) 121, 262
HpyCH4III ACNGT 1 cut(s) 19
HpyCH4V TGCA 2 cut(s) 206, 289
HpyF10VI GCNNNNNNNGC 2 cut(s) 73, 185
Hsp92I GRCGYC 1 cut(s) 100
Kzo9I GATC 2 cut(s) 294, 306
LmnI GCTCC 2 cut(s) 94, 113
Lsp1109I GCAGC 2 cut(s) 112, 301
MaeI CTAG 2 cut(s) 45, 222
MalI GATC 2 cut(s) 296, 308
MboI GATC 2 cut(s) 294, 306
MboII GAAGA 2 cut(s) 3, 21
MluCI AATT 2 cut(s) 77, 217
MnlI CCTC 2 cut(s) 47, 90
MseI TTAA 1 cut(s) 174
MspA1I CMGCKG 1 cut(s) 292
MspCI CTTAAG 1 cut(s) 173
MspR9I CCNGG 2 cut(s) 94, 199
MvaI CCWGG 2 cut(s) 94, 199
MwoI GCNNNNNNNGC 2 cut(s) 73, 185
NdeII GATC 2 cut(s) 294, 306
NlaIV GGNNCC 3 cut(s) 153, 180, 250
PfeI GAWTC 1 cut(s) 192
PkrI GCNGC 2 cut(s) 127, 291
Psp6I CCWGG 2 cut(s) 92, 197
PspFI CCCAGC 4 cut(s) 72, 85, 104, 140
PspGI CCWGG 2 cut(s) 92, 197
PspN4I GGNNCC 3 cut(s) 153, 180, 250
PspPI GGNCC 2 cut(s) 178, 316
PstI CTGCAG 2 cut(s) 208, 291
PvuII CAGCTG 1 cut(s) 292
RsaI GTAC 1 cut(s) 21
RsaNI GTAC 1 cut(s) 20
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 2 cut(s) 126, 290
Sau3AI GATC 2 cut(s) 294, 306
Sau96I GGNCC 2 cut(s) 178, 316
ScrFI CCNGG 2 cut(s) 94, 199
SetI ASST 6 cut(s) 91, 110, 127, 229, 254, 294
SfcI CTRYAG 2 cut(s) 204, 287
SmlI CTYRAG 1 cut(s) 173
SmoI CTYRAG 1 cut(s) 173
Sse9I AATT 2 cut(s) 77, 217
SsiI CCGC 1 cut(s) 65
SspMI CTAG 2 cut(s) 45, 222
StyD4I CCNGG 2 cut(s) 92, 197
TaaI ACNGT 1 cut(s) 19
TasI AATT 2 cut(s) 77, 217
TfiI GAWTC 1 cut(s) 192
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 2 cut(s) 125, 289
TspDTI ATGAA 1 cut(s) 244
Vha464I CTTAAG 1 cut(s) 173
XapI RAATTY 1 cut(s) 217
XbaI TCTAGA 1 cut(s) 221
XspI CTAG 2 cut(s) 45, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.