Rh3CG147400

High-light-induced protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
12310429 .. 12311185
757 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG147400.1

Sequence Viewer

Length: 363 bp
ATGGCAACTTCATCATCTACCATACTATCATCTTCCTTCCTCCCTGCTAGGGTTTTAACAGCAAATCATCCAACCCAGCAACTCTGTATTTTCCCAAATGGGACTTTGCATCGCACAGCCTCCACGAAGCGTGCCACCTTCAGCGTTCGAGCCGCCAAGCTTCCTCCTGGAGTAGTGGTGCCAAAAGTAGAGCCAAAGTTTCAGGCTCCTTTTCTTGGGTTCACCAGGACTGCAGAAATATGGAATTCTAGAGCTTGTATGATTGGACTAATTGGAACTTTCATCGTAGAATTGATATTGAACAAGGGGATACTGCAGCTGATTGGAGTGGAAATTGGAAAAGGTCTTGATATTCCTCTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

12.9

Weight (kDa)

10.29

Isoelectric Point (pI)

51.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013492)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 178
AciI CCGC 1 cut(s) 153
AcsI RAATTY 1 cut(s) 244
AcuI CTGAAG 1 cut(s) 124
AfiI CCNNNNNNNGG 2 cut(s) 49, 215
AgsI TTSAA 1 cut(s) 301
AjnI CCWGG 2 cut(s) 166, 224
AluBI AGCT 3 cut(s) 160, 254, 319
AluI AGCT 3 cut(s) 160, 254, 319
ApeKI GCWGC 1 cut(s) 316
ApoI RAATTY 1 cut(s) 244
AsuHPI GGTGA 1 cut(s) 214
BanI GGYRCC 1 cut(s) 178
BbvI GCAGC 1 cut(s) 328
BciT130I CCWGG 2 cut(s) 168, 226
BciVI GTATCC 1 cut(s) 303
BfaI CTAG 2 cut(s) 48, 249
BfmI CTRYAG 2 cut(s) 231, 314
BfuI GTATCC 1 cut(s) 303
BisI GCNGC 2 cut(s) 153, 317
BlsI GCNGC 2 cut(s) 154, 318
Bme1390I CCNGG 2 cut(s) 168, 226
BmiI GGNNCC 2 cut(s) 180, 207
BmrFI CCNGG 2 cut(s) 168, 226
BmsI GCATC 1 cut(s) 118
BpmI CTGGAG 1 cut(s) 189
BsaXI ACNNNNNCTCC 2 cut(s) 162, 192
Bsc4I CCNNNNNNNGG 2 cut(s) 49, 215
BseBI CCWGG 2 cut(s) 168, 226
BseGI GGATG 1 cut(s) 67
BseLI CCNNNNNNNGG 2 cut(s) 49, 215
BseXI GCAGC 1 cut(s) 328
BseYI CCCAGC 1 cut(s) 75
BshNI GGYRCC 1 cut(s) 178
BslFI GGGAC 1 cut(s) 115
BslI CCNNNNNNNGG 2 cut(s) 49, 215
BsmFI GGGAC 1 cut(s) 115
BspACI CCGC 1 cut(s) 153
BspLI GGNNCC 2 cut(s) 180, 207
BspMAI CTGCAG 2 cut(s) 235, 318
BspT107I GGYRCC 1 cut(s) 178
Bst2UI CCWGG 2 cut(s) 168, 226
BstC8I GCNNGC 1 cut(s) 132
BstF5I GGATG 1 cut(s) 67
BstNI CCWGG 2 cut(s) 168, 226
BstSCI CCNGG 2 cut(s) 166, 224
BstSFI CTRYAG 2 cut(s) 231, 314
BstV1I GCAGC 1 cut(s) 328
BsuI GTATCC 1 cut(s) 303
BtgZI GCGATG 1 cut(s) 95
BtsCI GGATG 1 cut(s) 67
Cac8I GCNNGC 1 cut(s) 132
CviJI RGCY 7 cut(s) 119, 152, 160, 193, 206, 254, 319
CviKI_1 RGCY 7 cut(s) 119, 152, 160, 193, 206, 254, 319
Eco57I CTGAAG 1 cut(s) 124
EcoRI GAATTC 1 cut(s) 244
EcoRII CCWGG 2 cut(s) 166, 224
FaiI YATR 3 cut(s) 23, 241, 260
FaqI GGGAC 1 cut(s) 115
Fnu4HI GCNGC 2 cut(s) 153, 317
FokI GGATG 1 cut(s) 54
Fsp4HI GCNGC 2 cut(s) 153, 317
FspBI CTAG 2 cut(s) 48, 249
GluI GCNGC 2 cut(s) 153, 317
GsaI CCCAGC 1 cut(s) 79
GsuI CTGGAG 1 cut(s) 189
HindIII AAGCTT 1 cut(s) 158
HphI GGTGA 1 cut(s) 214
Hpy166II GTNNAC 1 cut(s) 222
Hpy188III TCNNGA 2 cut(s) 249, 347
Hpy8I GTNNAC 1 cut(s) 222
HpyAV CCTTC 2 cut(s) 46, 148
HpyCH4V TGCA 3 cut(s) 109, 233, 316
LmnI GCTCC 1 cut(s) 211
LpnPI CCDG 7 cut(s) 57, 89, 153, 180, 188, 211, 238
Lsp1109I GCAGC 1 cut(s) 328
LweI GCATC 1 cut(s) 118
MaeI CTAG 2 cut(s) 48, 249
MboII GAAGA 1 cut(s) 24
MluCI AATT 4 cut(s) 244, 270, 290, 333
MmeI TCCRAC 1 cut(s) 95
MnlI CCTC 3 cut(s) 50, 130, 174
MseI TTAA 1 cut(s) 56
MspA1I CMGCKG 1 cut(s) 319
MspR9I CCNGG 2 cut(s) 168, 226
MvaI CCWGG 2 cut(s) 168, 226
NlaIV GGNNCC 2 cut(s) 180, 207
PfoI TCCNGGA 1 cut(s) 166
PkrI GCNGC 2 cut(s) 154, 318
Psp6I CCWGG 2 cut(s) 166, 224
PspFI CCCAGC 1 cut(s) 75
PspGI CCWGG 2 cut(s) 166, 224
PspN4I GGNNCC 2 cut(s) 180, 207
PstI CTGCAG 2 cut(s) 235, 318
PvuII CAGCTG 1 cut(s) 319
SaqAI TTAA 1 cut(s) 56
SatI GCNGC 2 cut(s) 153, 317
ScrFI CCNGG 2 cut(s) 168, 226
SetI ASST 5 cut(s) 140, 162, 256, 321, 346
SfaNI GCATC 1 cut(s) 118
SfcI CTRYAG 2 cut(s) 231, 314
Sse9I AATT 4 cut(s) 244, 270, 290, 333
SsiI CCGC 1 cut(s) 153
SspMI CTAG 2 cut(s) 48, 249
StyD4I CCNGG 2 cut(s) 166, 224
TaqI TCGA 1 cut(s) 148
TasI AATT 4 cut(s) 244, 270, 290, 333
TauI GCSGC 1 cut(s) 155
Tru1I TTAA 1 cut(s) 56
Tru9I TTAA 1 cut(s) 56
TseI GCWGC 1 cut(s) 316
TspDTI ATGAA 1 cut(s) 271
XapI RAATTY 1 cut(s) 244
XbaI TCTAGA 1 cut(s) 248
XspI CTAG 2 cut(s) 48, 249
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.