MD12G1145500.v1.1

High-light-induced protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Reverse (-)
22463796 .. 22464936
1141 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1145500.v1.1.491

Sequence Viewer

Length: 336 bp
ATGGCAACTTCATCTACCATACTCTCATCTTCTCTCCTCCACACTAGGGTTCTAACAGCAAATCGTCAAACCCAGCAACTCTGCCCAGCTCCCAGGAGGCGTGCCAGCTCCTTCACAGTTCAAGCTGCCAAGCTTCCTGCTGGGGTGGTGGTGCCAAAAGTAGAGCCAAAGTTTAAGGCCCCTTTTGCTGGATTCACCAGGACTGCAGAAATATGGAATTCTAGAGCATGTATGATCGGACTTATTGGAACCTTCATAGTGGAACTGATATTGAACAAGGGAATACTGCAGTTGATTGGAGTGGAGATTGGAAAAGGACTAGATATTCCTCTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

112

Amino Acids

11.94

Weight (kDa)

10.6

Isoelectric Point (pI)

62.2

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0013492)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 151
AcsI RAATTY 1 cut(s) 217
AfiI CCNNNNNNNGG 2 cut(s) 46, 188
AgsI TTSAA 2 cut(s) 122, 274
AjnI CCWGG 2 cut(s) 92, 197
AluBI AGCT 4 cut(s) 89, 108, 125, 133
AluI AGCT 4 cut(s) 89, 108, 125, 133
AoxI GGCC 1 cut(s) 177
ApeKI GCWGC 1 cut(s) 125
ApoI RAATTY 1 cut(s) 217
AspS9I GGNCC 1 cut(s) 178
AsuHPI GGTGA 1 cut(s) 187
BanI GGYRCC 1 cut(s) 151
BbvI GCAGC 1 cut(s) 112
BciT130I CCWGG 2 cut(s) 94, 199
BfaI CTAG 3 cut(s) 45, 222, 320
BfmI CTRYAG 2 cut(s) 204, 287
BisI GCNGC 1 cut(s) 126
BlsI GCNGC 1 cut(s) 127
Bme1390I CCNGG 2 cut(s) 94, 199
BmgT120I GGNCC 1 cut(s) 178
BmiI GGNNCC 3 cut(s) 153, 180, 250
BmrFI CCNGG 2 cut(s) 94, 199
BsaJI CCNNGG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 2 cut(s) 46, 188
BseBI CCWGG 2 cut(s) 94, 199
BseDI CCNNGG 1 cut(s) 92
BseLI CCNNNNNNNGG 2 cut(s) 46, 188
BseRI GAGGAG 1 cut(s) 26
BseXI GCAGC 1 cut(s) 112
BseYI CCCAGC 3 cut(s) 72, 85, 140
BshFI GGCC 1 cut(s) 179
BshNI GGYRCC 1 cut(s) 151
BslI CCNNNNNNNGG 2 cut(s) 46, 188
BsnI GGCC 1 cut(s) 179
Bsp143I GATC 1 cut(s) 234
BspANI GGCC 1 cut(s) 179
BspLI GGNNCC 3 cut(s) 153, 180, 250
BspMAI CTGCAG 2 cut(s) 208, 291
BspT107I GGYRCC 1 cut(s) 151
BssECI CCNNGG 1 cut(s) 92
BssMI GATC 1 cut(s) 234
Bst2UI CCWGG 2 cut(s) 94, 199
Bst4CI ACNGT 1 cut(s) 118
BstC8I GCNNGC 2 cut(s) 102, 106
BstKTI GATC 1 cut(s) 237
BstMBI GATC 1 cut(s) 234
BstMWI GCNNNNNNNGC 1 cut(s) 185
BstNI CCWGG 2 cut(s) 94, 199
BstNSI RCATGY 1 cut(s) 231
BstSCI CCNGG 2 cut(s) 92, 197
BstSFI CTRYAG 2 cut(s) 204, 287
BstV1I GCAGC 1 cut(s) 112
BsuRI GGCC 1 cut(s) 179
Cac8I GCNNGC 2 cut(s) 102, 106
Cfr13I GGNCC 1 cut(s) 178
CviAII CATG 1 cut(s) 228
CviJI RGCY 6 cut(s) 89, 108, 125, 133, 166, 179
CviKI_1 RGCY 6 cut(s) 89, 108, 125, 133, 166, 179
DpnI GATC 1 cut(s) 236
DpnII GATC 1 cut(s) 234
EcoO109I RGGNCCY 1 cut(s) 178
EcoRI GAATTC 1 cut(s) 217
EcoRII CCWGG 2 cut(s) 92, 197
FaeI CATG 1 cut(s) 231
FaiI YATR 5 cut(s) 20, 214, 229, 233, 257
FatI CATG 1 cut(s) 227
Fnu4HI GCNGC 1 cut(s) 126
Fsp4HI GCNGC 1 cut(s) 126
FspBI CTAG 3 cut(s) 45, 222, 320
GluI GCNGC 1 cut(s) 126
GsaI CCCAGC 3 cut(s) 76, 89, 144
HaeIII GGCC 1 cut(s) 179
Hin1II CATG 1 cut(s) 231
HindIII AAGCTT 1 cut(s) 131
HinfI GANTC 1 cut(s) 192
HphI GGTGA 1 cut(s) 187
Hpy188I TCNGA 1 cut(s) 239
Hpy188III TCNNGA 1 cut(s) 222
HpyAV CCTTC 2 cut(s) 121, 262
HpyCH4III ACNGT 1 cut(s) 118
HpyCH4V TGCA 2 cut(s) 206, 289
HpyF10VI GCNNNNNNNGC 1 cut(s) 185
Hsp92II CATG 1 cut(s) 231
Kzo9I GATC 1 cut(s) 234
LmnI GCTCC 2 cut(s) 94, 113
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 3 cut(s) 45, 222, 320
MalI GATC 1 cut(s) 236
MboI GATC 1 cut(s) 234
MboII GAAGA 1 cut(s) 21
MluCI AATT 1 cut(s) 217
MnlI CCTC 2 cut(s) 47, 90
MseI TTAA 1 cut(s) 174
MspR9I CCNGG 2 cut(s) 94, 199
MvaI CCWGG 2 cut(s) 94, 199
MwoI GCNNNNNNNGC 1 cut(s) 185
NdeII GATC 1 cut(s) 234
NlaIII CATG 1 cut(s) 231
NlaIV GGNNCC 3 cut(s) 153, 180, 250
NspI RCATGY 1 cut(s) 231
PfeI GAWTC 1 cut(s) 192
PkrI GCNGC 1 cut(s) 127
Psp6I CCWGG 2 cut(s) 92, 197
PspFI CCCAGC 3 cut(s) 72, 85, 140
PspGI CCWGG 2 cut(s) 92, 197
PspN4I GGNNCC 3 cut(s) 153, 180, 250
PspPI GGNCC 1 cut(s) 178
PstI CTGCAG 2 cut(s) 208, 291
SaqAI TTAA 1 cut(s) 174
SatI GCNGC 1 cut(s) 126
Sau3AI GATC 1 cut(s) 234
Sau96I GGNCC 1 cut(s) 178
ScrFI CCNGG 2 cut(s) 94, 199
SetI ASST 5 cut(s) 91, 110, 127, 135, 254
SfcI CTRYAG 2 cut(s) 204, 287
Sse9I AATT 1 cut(s) 217
SspMI CTAG 3 cut(s) 45, 222, 320
StyD4I CCNGG 2 cut(s) 92, 197
TaaI ACNGT 1 cut(s) 118
TasI AATT 1 cut(s) 217
TfiI GAWTC 1 cut(s) 192
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TseI GCWGC 1 cut(s) 125
TspDTI ATGAA 1 cut(s) 244
XapI RAATTY 1 cut(s) 217
XbaI TCTAGA 1 cut(s) 221
XceI RCATGY 1 cut(s) 231
XspI CTAG 3 cut(s) 45, 222, 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.