MD04G1157000.v1.1

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
OG0019281
Physical Location & Seq
Reverse (-)
24533814 .. 24534161
348 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1157000.v1.1.491

Sequence Viewer

Length: 348 bp
ATGGGTCATCTACAGAACCTAAAATATCTTAACCCTTCTCAAAATTTCTTCCGTGGGAAAATTCCAACTAATATTTCTCGATGTACACAACTAAGATTGCTTAATCTAGAAGACAATCGGATTATCAGGTCCATTCCGAACCAACTCAGTTCATTGTTGAATTTAAAATGTCTACGGCTTTTTGGTAACTGTCTCACTAGAACCATCCCACCTTGGACAGGAAACTTTTCTCTGTTGAACAATCTTTATCCTGGCGATAACAATTTTCAAGGAAGCATACCCGATGAGCTGGGGCATATAACAGGCTTGGAGAAGTTCGAATTTGAGTTGAATAACTATCTGGTATGA

Protein Analysis

116

Amino Acids

13.24

Weight (kDa)

8.96

Isoelectric Point (pI)

27.97

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_14 PF23598 2 - 111 1.1e-08 Leucine-rich repeat region
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019281)

Species Orthologous Gene IDs
malus_domestica MD04G1157000.v1.1
pyrus_communis pycom04g10550
rosa_chinensis RchiOBHm_Chr0c16g0499791 RchiOBHm_Chr0c16g0499851
rosa_multiflora Rmu_sc0005297.1_g000007 Rmu_sc0006522.1_g000025
rosa_samantha Rh3AG121900 Rh6BG302000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 172
AcsI RAATTY 4 cut(s) 43, 60, 160, 320
AfaI GTAC 1 cut(s) 85
AfiI CCNNNNNNNGG 1 cut(s) 218
AgsI TTSAA 4 cut(s) 160, 238, 269, 331
AjnI CCWGG 1 cut(s) 250
AjuI GAANNNNNNNTTGG 2 cut(s) 58, 90
AluBI AGCT 1 cut(s) 289
AluI AGCT 1 cut(s) 289
Alw26I GTCTC 1 cut(s) 197
ApoI RAATTY 4 cut(s) 43, 60, 160, 320
Asp700I GAANNNNTTC 1 cut(s) 226
AspS9I GGNCC 1 cut(s) 129
AsuII TTCGAA 1 cut(s) 318
AvaII GGWCC 1 cut(s) 129
BbsI GAAGAC 1 cut(s) 117
BccI CCATC 1 cut(s) 212
BceAI ACGGC 1 cut(s) 191
BciT130I CCWGG 1 cut(s) 252
BcoDI GTCTC 1 cut(s) 197
BfaI CTAG 2 cut(s) 107, 198
BfmI CTRYAG 1 cut(s) 11
Bme1390I CCNGG 1 cut(s) 252
Bme18I GGWCC 1 cut(s) 129
BmgT120I GGNCC 1 cut(s) 129
BmrFI CCNGG 1 cut(s) 252
BpiI GAAGAC 1 cut(s) 117
Bpu14I TTCGAA 1 cut(s) 318
BsaJI CCNNGG 2 cut(s) 52, 212
Bsc4I CCNNNNNNNGG 1 cut(s) 218
BseBI CCWGG 1 cut(s) 252
BseDI CCNNGG 2 cut(s) 52, 212
BseGI GGATG 1 cut(s) 204
BseLI CCNNNNNNNGG 1 cut(s) 218
BseMII CTCAG 1 cut(s) 160
BseYI CCCAGC 1 cut(s) 289
BslI CCNNNNNNNGG 1 cut(s) 218
BsmAI GTCTC 1 cut(s) 197
Bsp119I TTCGAA 1 cut(s) 318
Bsp1407I TGTACA 1 cut(s) 83
BspCNI CTCAG 1 cut(s) 159
BspT104I TTCGAA 1 cut(s) 318
BsrGI TGTACA 1 cut(s) 83
BssECI CCNNGG 2 cut(s) 52, 212
BssT1I CCWWGG 1 cut(s) 212
Bst2UI CCWGG 1 cut(s) 252
Bst4CI ACNGT 1 cut(s) 191
BstAUI TGTACA 1 cut(s) 83
BstBI TTCGAA 1 cut(s) 318
BstDEI CTNAG 2 cut(s) 92, 146
BstDSI CCRYGG 1 cut(s) 52
BstENI CCTNNNNNAGG 1 cut(s) 216
BstF5I GGATG 1 cut(s) 204
BstMAI GTCTC 1 cut(s) 197
BstNI CCWGG 1 cut(s) 252
BstSCI CCNGG 1 cut(s) 250
BstSFI CTRYAG 1 cut(s) 11
BstV2I GAAGAC 1 cut(s) 117
BtgI CCRYGG 1 cut(s) 52
BtsCI GGATG 1 cut(s) 204
Cfr13I GGNCC 1 cut(s) 129
Csp6I GTAC 1 cut(s) 84
CviJI RGCY 3 cut(s) 178, 289, 306
CviKI_1 RGCY 3 cut(s) 178, 289, 306
CviQI GTAC 1 cut(s) 84
DdeI CTNAG 2 cut(s) 92, 146
DraI TTTAAA 1 cut(s) 165
Eco130I CCWWGG 1 cut(s) 212
Eco47I GGWCC 1 cut(s) 129
EcoNI CCTNNNNNAGG 1 cut(s) 216
EcoRII CCWGG 1 cut(s) 250
EcoT14I CCWWGG 1 cut(s) 212
ErhI CCWWGG 1 cut(s) 212
FaiI YATR 4 cut(s) 278, 297, 299, 346
FblI GTMKAC 1 cut(s) 172
FokI GGATG 1 cut(s) 191
FspBI CTAG 2 cut(s) 107, 198
GsaI CCCAGC 1 cut(s) 293
Hpy166II GTNNAC 2 cut(s) 86, 173
Hpy188I TCNGA 2 cut(s) 120, 138
Hpy188III TCNNGA 2 cut(s) 78, 107
Hpy8I GTNNAC 2 cut(s) 86, 173
HpyAV CCTTC 1 cut(s) 45
HpyCH4III ACNGT 1 cut(s) 191
HpyF3I CTNAG 2 cut(s) 92, 146
LpnPI CCDG 7 cut(s) 112, 204, 237, 264, 275, 288, 326
MaeI CTAG 2 cut(s) 107, 198
MaeIII GTNAC 1 cut(s) 185
MboII GAAGA 2 cut(s) 40, 122
MluCI AATT 5 cut(s) 43, 60, 160, 262, 320
MmeI TCCRAC 1 cut(s) 89
MroXI GAANNNNTTC 1 cut(s) 226
MseI TTAA 3 cut(s) 30, 102, 164
MspR9I CCNGG 1 cut(s) 252
MvaI CCWGG 1 cut(s) 252
NspV TTCGAA 1 cut(s) 318
PdmI GAANNNNTTC 1 cut(s) 226
Psp6I CCWGG 1 cut(s) 250
PspFI CCCAGC 1 cut(s) 289
PspGI CCWGG 1 cut(s) 250
PspPI GGNCC 1 cut(s) 129
RsaI GTAC 1 cut(s) 85
RsaNI GTAC 1 cut(s) 84
SaqAI TTAA 3 cut(s) 30, 102, 164
Sau96I GGNCC 1 cut(s) 129
ScrFI CCNGG 1 cut(s) 252
SetI ASST 4 cut(s) 21, 131, 214, 291
SfcI CTRYAG 1 cut(s) 11
SfuI TTCGAA 1 cut(s) 318
SinI GGWCC 1 cut(s) 129
Sse9I AATT 5 cut(s) 43, 60, 160, 262, 320
SspI AATATT 1 cut(s) 73
SspMI CTAG 2 cut(s) 107, 198
StyD4I CCNGG 1 cut(s) 250
StyI CCWWGG 1 cut(s) 212
TaaI ACNGT 1 cut(s) 191
TaqI TCGA 2 cut(s) 79, 318
TasI AATT 5 cut(s) 43, 60, 160, 262, 320
TatI WGTACW 1 cut(s) 83
Tru1I TTAA 3 cut(s) 30, 102, 164
Tru9I TTAA 3 cut(s) 30, 102, 164
TspDTI ATGAA 1 cut(s) 141
TspGWI ACGGA 1 cut(s) 41
VpaK11BI GGWCC 1 cut(s) 129
XagI CCTNNNNNAGG 1 cut(s) 216
XapI RAATTY 4 cut(s) 43, 60, 160, 320
XbaI TCTAGA 1 cut(s) 106
XmiI GTMKAC 1 cut(s) 172
XmnI GAANNNNTTC 1 cut(s) 226
XspI CTAG 2 cut(s) 107, 198
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.