Rmu_sc0005297.1_g000007

LRR receptor-like serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0005297.1
OG0019281
Physical Location & Seq
Forward (+)
26424 .. 27362
939 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0005297.1_g000007.1.cds

Sequence Viewer

Length: 939 bp
atgggcaaattaacggagcttcagtttctaagtctctacaacaacaatcttaatggtaccattccctatcagctggacagtctcaaaaaggtacaatatttgcttcttggaaggaacaagttagacactcctaactggtctaaattttcaggctttcctttgttaacatccctggatctttctctgaacagtttggattcagaattcccagaatttatatctgagtgtaggaacttgaccttcctggatttgtctagaaatcgtttgactggccagataccgaaactggtagttaccaacatggtgaagcttgaacatctcaatctcaccaataacctattccaagggccaatgccatataactttcccaagcttaaacaccttcatttggcacaaaacaacttcaatggtacaattcctgaagatattggcttcatatctagtttgcaacgggttgacctgtttaacaattcccttgaaagcaaaatcccatcctctgtaggccaactcagggagcttcagcaccttgaccttggtgagaattccttgaactcttcaatcccttctgaccttggtctttgtacaaacctctcttatttggccttggctgtgaataaactcagtggggaactgcctctatccttgtccaatctcgaaagcttggtggagttgggattacctgataatctatttactgggccaaccttgccttctttggtctccaattggactgaaatgatctctttgcaactccaaaacaatagactcagtgggaatcttctagcagaacttggcctgtcgaaaagacttgatatcctcaatctgcacagcaataacttctctggatcaattccctcagacataggaaacttgcaagttttgacaaaattggatctctctagcaacaaacttgatggggaattgccaacaaaggcgtag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
LRRNT_2 LRR_1 LRR_4 LRR_6 LRR_8 Pkinase Pkinase_Tyr

Protein Analysis

312

Amino Acids

34.57

Weight (kDa)

5.41

Isoelectric Point (pI)

28.28

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019281)

Species Orthologous Gene IDs
malus_domestica MD04G1157000.v1.1
pyrus_communis pycom04g10550
rosa_chinensis RchiOBHm_Chr0c16g0499791 RchiOBHm_Chr0c16g0499851
rosa_multiflora Rmu_sc0005297.1_g000007 Rmu_sc0006522.1_g000025
rosa_samantha Rh3AG121900 Rh6BG302000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 56
AccB1I GGYRCC 1 cut(s) 56
AclWI GGATC 3 cut(s) 183, 853, 900
AcoI YGGCCR 1 cut(s) 271
AcsI RAATTY 4 cut(s) 143, 203, 212, 541
AcuI CTGAAG 3 cut(s) 5, 441, 503
AfaI GTAC 4 cut(s) 58, 93, 412, 583
AfiI CCNNNNNNNGG 2 cut(s) 388, 511
AgsI TTSAA 5 cut(s) 314, 406, 479, 550, 558
AjnI CCWGG 2 cut(s) 171, 243
AjuI GAANNNNNNNTTGG 4 cut(s) 323, 355, 694, 726
AluBI AGCT 6 cut(s) 19, 73, 310, 373, 517, 660
AluI AGCT 6 cut(s) 19, 73, 310, 373, 517, 660
Alw26I GTCTC 3 cut(s) 38, 86, 724
AlwI GGATC 3 cut(s) 183, 853, 900
AoxI GGCC 6 cut(s) 271, 347, 502, 600, 698, 793
ApoI RAATTY 4 cut(s) 143, 203, 212, 541
Asp718I GGTACC 1 cut(s) 56
AspS9I GGNCC 2 cut(s) 347, 698
AsuHPI GGTGA 3 cut(s) 316, 319, 548
BalI TGGCCA 1 cut(s) 273
BanI GGYRCC 1 cut(s) 56
BccI CCATC 2 cut(s) 499, 908
BciT130I CCWGG 2 cut(s) 173, 245
BcoDI GTCTC 3 cut(s) 38, 86, 724
BfaI CTAG 4 cut(s) 255, 441, 782, 900
BfmI CTRYAG 1 cut(s) 498
Bme1390I CCNGG 2 cut(s) 173, 245
BmgT120I GGNCC 2 cut(s) 347, 698
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 2 cut(s) 173, 245
BmrI ACTGGG 1 cut(s) 705
BmuI ACTGGG 1 cut(s) 705
BoxI GACNNNNGTC 1 cut(s) 573
BsaI GGTCTC 1 cut(s) 724
BsaJI CCNNGG 5 cut(s) 171, 343, 532, 571, 603
BsaXI ACNNNNNCTCC 2 cut(s) 8, 38
Bsc4I CCNNNNNNNGG 2 cut(s) 388, 511
Bse1I ACTGG 4 cut(s) 140, 274, 291, 700
BseBI CCWGG 2 cut(s) 173, 245
BseDI CCNNGG 5 cut(s) 171, 343, 532, 571, 603
BseGI GGATG 2 cut(s) 167, 491
BseLI CCNNNNNNNGG 2 cut(s) 388, 511
BseMII CTCAG 5 cut(s) 213, 523, 634, 781, 870
BseNI ACTGG 4 cut(s) 140, 274, 291, 700
BsgI GTGCAG 1 cut(s) 809
BshFI GGCC 6 cut(s) 273, 349, 504, 602, 700, 795
BshNI GGYRCC 1 cut(s) 56
BslI CCNNNNNNNGG 2 cut(s) 388, 511
BsmAI GTCTC 3 cut(s) 38, 86, 724
BsnI GGCC 6 cut(s) 273, 349, 504, 602, 700, 795
Bso31I GGTCTC 1 cut(s) 724
Bsp1407I TGTACA 1 cut(s) 581
Bsp143I GATC 4 cut(s) 175, 738, 845, 892
BspANI GGCC 6 cut(s) 273, 349, 504, 602, 700, 795
BspCNI CTCAG 5 cut(s) 214, 522, 633, 780, 869
BspLI GGNNCC 1 cut(s) 58
BspPI GGATC 3 cut(s) 183, 853, 900
BspT107I GGYRCC 1 cut(s) 56
BspTNI GGTCTC 1 cut(s) 724
BsrGI TGTACA 1 cut(s) 581
BsrI ACTGG 4 cut(s) 140, 274, 291, 700
BssECI CCNNGG 5 cut(s) 171, 343, 532, 571, 603
BssMI GATC 4 cut(s) 175, 738, 845, 892
BssT1I CCWWGG 4 cut(s) 343, 532, 571, 603
Bst2UI CCWGG 2 cut(s) 173, 245
Bst4CI ACNGT 2 cut(s) 80, 191
Bst6I CTCTTC 1 cut(s) 559
BstAUI TGTACA 1 cut(s) 581
BstDEI CTNAG 6 cut(s) 29, 222, 509, 620, 767, 856
BstF5I GGATG 2 cut(s) 167, 491
BstKTI GATC 4 cut(s) 178, 741, 848, 895
BstMAI GTCTC 3 cut(s) 38, 86, 724
BstMBI GATC 4 cut(s) 175, 738, 845, 892
BstMWI GCNNNNNNNGC 1 cut(s) 706
BstNI CCWGG 2 cut(s) 173, 245
BstPAI GACNNNNGTC 1 cut(s) 573
BstSCI CCNGG 2 cut(s) 171, 243
BstSFI CTRYAG 1 cut(s) 498
BstX2I RGATCY 2 cut(s) 175, 892
BstYI RGATCY 2 cut(s) 175, 892
BsuRI GGCC 6 cut(s) 273, 349, 504, 602, 700, 795
BtsCI GGATG 2 cut(s) 167, 491
BtsIMutI CAGTG 2 cut(s) 628, 775
Cfr13I GGNCC 2 cut(s) 347, 698
Csp6I GTAC 4 cut(s) 57, 92, 411, 582
CviAII CATG 1 cut(s) 301
CviQI GTAC 4 cut(s) 57, 92, 411, 582
DdeI CTNAG 6 cut(s) 29, 222, 509, 620, 767, 856
DpnI GATC 4 cut(s) 177, 740, 847, 894
DpnII GATC 4 cut(s) 175, 738, 845, 892
EaeI YGGCCR 1 cut(s) 271
Eam1104I CTCTTC 1 cut(s) 559
EarI CTCTTC 1 cut(s) 559
Eco130I CCWWGG 4 cut(s) 343, 532, 571, 603
Eco31I GGTCTC 1 cut(s) 724
Eco32I GATATC 1 cut(s) 814
Eco57I CTGAAG 3 cut(s) 5, 441, 503
EcoRI GAATTC 2 cut(s) 203, 541
EcoRII CCWGG 2 cut(s) 171, 243
EcoRV GATATC 1 cut(s) 814
EcoT14I CCWWGG 4 cut(s) 343, 532, 571, 603
ErhI CCWWGG 4 cut(s) 343, 532, 571, 603
FaeI CATG 1 cut(s) 304
FaiI YATR 6 cut(s) 218, 302, 358, 360, 437, 863
FatI CATG 1 cut(s) 300
FokI GGATG 2 cut(s) 154, 478
FspBI CTAG 4 cut(s) 255, 441, 782, 900
HaeIII GGCC 6 cut(s) 273, 349, 504, 602, 700, 795
Hin1II CATG 1 cut(s) 304
HincII GTYRAC 2 cut(s) 165, 457
HindII GTYRAC 2 cut(s) 165, 457
HindIII AAGCTT 3 cut(s) 308, 371, 658
HinfI GANTC 3 cut(s) 197, 765, 775
HpaI GTTAAC 1 cut(s) 165
HphI GGTGA 3 cut(s) 316, 319, 548
Hpy166II GTNNAC 2 cut(s) 165, 457
Hpy188I TCNGA 5 cut(s) 186, 202, 223, 568, 859
Hpy188III TCNNGA 4 cut(s) 255, 419, 653, 843
Hpy8I GTNNAC 2 cut(s) 165, 457
HpyAV CCTTC 5 cut(s) 105, 250, 392, 573, 720
HpyCH4III ACNGT 2 cut(s) 80, 191
HpyCH4V TGCA 4 cut(s) 448, 748, 826, 874
HpyF10VI GCNNNNNNNGC 1 cut(s) 706
HpyF3I CTNAG 6 cut(s) 29, 222, 509, 620, 767, 856
Hsp92II CATG 1 cut(s) 304
KpnI GGTACC 1 cut(s) 60
KspAI GTTAAC 1 cut(s) 165
Kzo9I GATC 4 cut(s) 175, 738, 845, 892
LmnI GCTCC 2 cut(s) 16, 514
MaeI CTAG 4 cut(s) 255, 441, 782, 900
MaeIII GTNAC 1 cut(s) 292
MalI GATC 4 cut(s) 177, 740, 847, 894
MboI GATC 4 cut(s) 175, 738, 845, 892
MboII GAAGA 3 cut(s) 434, 546, 770
MfeI CAATTG 1 cut(s) 724
MflI RGATCY 2 cut(s) 175, 892
MlsI TGGCCA 1 cut(s) 273
MluNI TGGCCA 1 cut(s) 273
MlyI GAGTC 1 cut(s) 759
MnlI CCTC 5 cut(s) 505, 599, 645, 827, 865
Mox20I TGGCCA 1 cut(s) 273
MscI TGGCCA 1 cut(s) 273
MseI TTAA 5 cut(s) 11, 51, 164, 375, 465
Msp20I TGGCCA 1 cut(s) 273
MspA1I CMGCKG 1 cut(s) 73
MspR9I CCNGG 2 cut(s) 173, 245
MunI CAATTG 1 cut(s) 724
MvaI CCWGG 2 cut(s) 173, 245
MwoI GCNNNNNNNGC 1 cut(s) 706
NdeII GATC 4 cut(s) 175, 738, 845, 892
NlaIII CATG 1 cut(s) 304
NlaIV GGNNCC 1 cut(s) 58
PfeI GAWTC 2 cut(s) 197, 775
PfoI TCCNGGA 1 cut(s) 243
PleI GAGTC 1 cut(s) 759
PpsI GAGTC 1 cut(s) 759
PshAI GACNNNNGTC 1 cut(s) 573
Psp6I CCWGG 2 cut(s) 171, 243
PspGI CCWGG 2 cut(s) 171, 243
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 2 cut(s) 347, 698
PsuI RGATCY 2 cut(s) 175, 892
PvuII CAGCTG 1 cut(s) 73
RsaI GTAC 4 cut(s) 58, 93, 412, 583
RsaNI GTAC 4 cut(s) 57, 92, 411, 582
SaqAI TTAA 5 cut(s) 11, 51, 164, 375, 465
Sau3AI GATC 4 cut(s) 175, 738, 845, 892
Sau96I GGNCC 2 cut(s) 347, 698
SchI GAGTC 1 cut(s) 759
ScrFI CCNGG 2 cut(s) 173, 245
SfcI CTRYAG 1 cut(s) 498
SspI AATATT 1 cut(s) 98
SspMI CTAG 4 cut(s) 255, 441, 782, 900
StyD4I CCNGG 2 cut(s) 171, 243
StyI CCWWGG 4 cut(s) 343, 532, 571, 603
TaaI ACNGT 2 cut(s) 80, 191
TaqI TCGA 2 cut(s) 654, 800
TatI WGTACW 1 cut(s) 581
TfiI GAWTC 2 cut(s) 197, 775
Tru1I TTAA 5 cut(s) 11, 51, 164, 375, 465
Tru9I TTAA 5 cut(s) 11, 51, 164, 375, 465
TscAI CASTG 2 cut(s) 628, 775
TspDTI ATGAA 2 cut(s) 374, 424
TspGWI ACGGA 1 cut(s) 29
TspRI CASTG 2 cut(s) 628, 775
XapI RAATTY 4 cut(s) 143, 203, 212, 541
XbaI TCTAGA 1 cut(s) 254
XspI CTAG 4 cut(s) 255, 441, 782, 900
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.