Rh6BG302000

LRR receptor-like serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6B
Physical Location & Seq
Forward (+)
53129149 .. 53129541
393 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6BG302000.1

Sequence Viewer

Length: 393 bp
ATGGGCAAATTAATGGAGCTTCAGTTTCTAAGTCTCTACAACAACTATCTCAATGGTACCATTCCCTATCAGCTGGACAATCTCAAAAAGGTACAATATTTGCTTCTTGGAGATAACTACTTAGACACTCCTGACTGGTCTAAATTTTCAGGCTTTCCTGTGTTGACATTCCTTGATCTTTCTCTGAACTTTTTAGATTCAGAATTTCCAGAATTTTTATCTGAATGTAGGAACTTGACCATCCTTGATTTGTCTGAAAATCATTTGACTGGCCAAATACCAATATTGGTAGTTACCAACCTGGTCAAGCTTGAATCTCTCAATCTCACCAATAACCAATTCCAAGGACCATTCCCGTATAACTTTCCCAACCTGAAGCACCTTTATCTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.

Protein Analysis

130

Amino Acids

15.08

Weight (kDa)

4.6

Isoelectric Point (pI)

21.93

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
LRR_8 PF13855 7 - 63 1.5e-06 Leucine rich repeat
LRR_8 PF13855 36 - 89 2.9e-06 Leucine rich repeat
LRR_4 PF12799 78 - 113 1e-05 Leucine Rich repeats (2 copies)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019281)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 56
AccB1I GGYRCC 1 cut(s) 56
AcoI YGGCCR 1 cut(s) 271
AcsI RAATTY 3 cut(s) 143, 203, 212
AcuI CTGAAG 1 cut(s) 5
AfaI GTAC 2 cut(s) 58, 93
AgsI TTSAA 1 cut(s) 314
AjnI CCWGG 1 cut(s) 300
AjuI GAANNNNNNNTTGG 2 cut(s) 323, 355
AluBI AGCT 3 cut(s) 19, 73, 310
AluI AGCT 3 cut(s) 19, 73, 310
Alw26I GTCTC 1 cut(s) 38
AoxI GGCC 1 cut(s) 271
ApoI RAATTY 3 cut(s) 143, 203, 212
AseI ATTAAT 1 cut(s) 11
Asp718I GGTACC 1 cut(s) 56
AspS9I GGNCC 1 cut(s) 347
AsuHPI GGTGA 1 cut(s) 319
AvaII GGWCC 1 cut(s) 347
BalI TGGCCA 1 cut(s) 273
BanI GGYRCC 1 cut(s) 56
BccI CCATC 1 cut(s) 248
BciT130I CCWGG 1 cut(s) 302
BcoDI GTCTC 1 cut(s) 38
Bme1390I CCNGG 1 cut(s) 302
Bme18I GGWCC 1 cut(s) 347
BmgT120I GGNCC 1 cut(s) 347
BmiI GGNNCC 1 cut(s) 58
BmrFI CCNGG 1 cut(s) 302
BsaJI CCNNGG 1 cut(s) 343
BsaXI ACNNNNNCTCC 2 cut(s) 8, 38
Bse1I ACTGG 2 cut(s) 140, 274
BseBI CCWGG 1 cut(s) 302
BseDI CCNNGG 1 cut(s) 343
BseGI GGATG 1 cut(s) 240
BseNI ACTGG 2 cut(s) 140, 274
BshFI GGCC 1 cut(s) 273
BshNI GGYRCC 1 cut(s) 56
BsmAI GTCTC 1 cut(s) 38
BsnI GGCC 1 cut(s) 273
Bsp143I GATC 1 cut(s) 175
BspANI GGCC 1 cut(s) 273
BspLI GGNNCC 1 cut(s) 58
BspT107I GGYRCC 1 cut(s) 56
BsrI ACTGG 2 cut(s) 140, 274
BssECI CCNNGG 1 cut(s) 343
BssMI GATC 1 cut(s) 175
BssT1I CCWWGG 1 cut(s) 343
Bst2UI CCWGG 1 cut(s) 302
BstDEI CTNAG 2 cut(s) 29, 121
BstF5I GGATG 1 cut(s) 240
BstKTI GATC 1 cut(s) 178
BstMAI GTCTC 1 cut(s) 38
BstMBI GATC 1 cut(s) 175
BstNI CCWGG 1 cut(s) 302
BstSCI CCNGG 1 cut(s) 300
BsuRI GGCC 1 cut(s) 273
BtsCI GGATG 1 cut(s) 240
Cfr13I GGNCC 1 cut(s) 347
CsiI ACCWGGT 1 cut(s) 300
Csp6I GTAC 2 cut(s) 57, 92
CviJI RGCY 5 cut(s) 19, 73, 153, 273, 310
CviKI_1 RGCY 5 cut(s) 19, 73, 153, 273, 310
CviQI GTAC 2 cut(s) 57, 92
DdeI CTNAG 2 cut(s) 29, 121
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
EaeI YGGCCR 1 cut(s) 271
Eco130I CCWWGG 1 cut(s) 343
Eco47I GGWCC 1 cut(s) 347
Eco57I CTGAAG 1 cut(s) 5
EcoRII CCWGG 1 cut(s) 300
EcoT14I CCWWGG 1 cut(s) 343
ErhI CCWWGG 1 cut(s) 343
FaiI YATR 1 cut(s) 360
FokI GGATG 1 cut(s) 227
HaeIII GGCC 1 cut(s) 273
HincII GTYRAC 1 cut(s) 165
HindII GTYRAC 1 cut(s) 165
HindIII AAGCTT 1 cut(s) 308
HinfI GANTC 2 cut(s) 197, 314
HphI GGTGA 1 cut(s) 319
Hpy166II GTNNAC 1 cut(s) 165
Hpy188I TCNGA 4 cut(s) 186, 202, 223, 256
Hpy188III TCNNGA 2 cut(s) 131, 209
Hpy8I GTNNAC 1 cut(s) 165
HpyF3I CTNAG 2 cut(s) 29, 121
KpnI GGTACC 1 cut(s) 60
Kzo9I GATC 1 cut(s) 175
LmnI GCTCC 1 cut(s) 16
MabI ACCWGGT 1 cut(s) 300
MaeIII GTNAC 1 cut(s) 292
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MlsI TGGCCA 1 cut(s) 273
MluCI AATT 5 cut(s) 8, 143, 203, 212, 338
MluNI TGGCCA 1 cut(s) 273
Mox20I TGGCCA 1 cut(s) 273
MscI TGGCCA 1 cut(s) 273
MseI TTAA 2 cut(s) 11, 391
Msp20I TGGCCA 1 cut(s) 273
MspA1I CMGCKG 1 cut(s) 73
MspR9I CCNGG 1 cut(s) 302
MvaI CCWGG 1 cut(s) 302
NdeII GATC 1 cut(s) 175
NlaIV GGNNCC 1 cut(s) 58
PfeI GAWTC 2 cut(s) 197, 314
PshBI ATTAAT 1 cut(s) 11
Psp6I CCWGG 1 cut(s) 300
PspGI CCWGG 1 cut(s) 300
PspN4I GGNNCC 1 cut(s) 58
PspPI GGNCC 1 cut(s) 347
PvuII CAGCTG 1 cut(s) 73
RsaI GTAC 2 cut(s) 58, 93
RsaNI GTAC 2 cut(s) 57, 92
SaqAI TTAA 2 cut(s) 11, 391
Sau3AI GATC 1 cut(s) 175
Sau96I GGNCC 1 cut(s) 347
ScrFI CCNGG 1 cut(s) 302
SetI ASST 7 cut(s) 21, 75, 93, 303, 312, 375, 384
SexAI ACCWGGT 1 cut(s) 300
SinI GGWCC 1 cut(s) 347
Sse9I AATT 5 cut(s) 8, 143, 203, 212, 338
SspI AATATT 2 cut(s) 98, 285
StyD4I CCNGG 1 cut(s) 300
StyI CCWWGG 1 cut(s) 343
TasI AATT 5 cut(s) 8, 143, 203, 212, 338
TfiI GAWTC 2 cut(s) 197, 314
Tru1I TTAA 2 cut(s) 11, 391
Tru9I TTAA 2 cut(s) 11, 391
VpaK11BI GGWCC 1 cut(s) 347
VspI ATTAAT 1 cut(s) 11
XapI RAATTY 3 cut(s) 143, 203, 212
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.