MD04G1240900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr04
Physical Location & Seq
Reverse (-)
31821574 .. 31823195
1622 bp
Loading structure...
UTR
Exon/CDS
Intron
MD04G1240900.v1.1.491

Sequence Viewer

Length: 264 bp
ATGAGAACTCCGCCTTCTCTGCTATCTCTCACCATTGACTTAGCTGTCCTCAACCTCCCCAGTATATCCGATCTCTCTCCTCTCCCTGACCACATCCTCCTCGATCTCTTCCTGAAAACTTTGAGAGCAGGAAAGCTAAATGAGAAAGTGTTGAAGCTGTTTGTAGCAACTGGCAAGGAAGAAGTCCTTTCACTAATCCAGTCACTTAATATTCGGCAGACCCTCACCCCTGTCCTTCCTACCAGATGCTCTGAAAAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.65

Weight (kDa)

8.98

Isoelectric Point (pI)

48.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018723)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 44
AciI CCGC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 154
AluBI AGCT 3 cut(s) 44, 136, 157
AluI AGCT 3 cut(s) 44, 136, 157
AsuHPI GGTGA 2 cut(s) 22, 217
BmrI ACTGGG 1 cut(s) 54
BmsI GCATC 1 cut(s) 236
BmuI ACTGGG 1 cut(s) 54
Bse1I ACTGG 3 cut(s) 60, 175, 199
BseGI GGATG 1 cut(s) 93
BseNI ACTGG 3 cut(s) 60, 175, 199
BseRI GAGGAG 2 cut(s) 69, 89
Bsp143I GATC 2 cut(s) 70, 103
BspACI CCGC 1 cut(s) 11
BsrI ACTGG 3 cut(s) 60, 175, 199
BssMI GATC 2 cut(s) 70, 103
Bst6I CTCTTC 1 cut(s) 113
BstDEI CTNAG 1 cut(s) 40
BstF5I GGATG 1 cut(s) 93
BstKTI GATC 2 cut(s) 73, 106
BstMBI GATC 2 cut(s) 70, 103
BstMWI GCNNNNNNNGC 1 cut(s) 19
BtsCI GGATG 1 cut(s) 93
CviJI RGCY 3 cut(s) 44, 136, 157
CviKI_1 RGCY 3 cut(s) 44, 136, 157
DdeI CTNAG 1 cut(s) 40
DpnI GATC 2 cut(s) 72, 105
DpnII GATC 2 cut(s) 70, 103
DrdI GACNNNNNNGTC 1 cut(s) 44
DseDI GACNNNNNNGTC 1 cut(s) 44
Eam1104I CTCTTC 1 cut(s) 113
EarI CTCTTC 1 cut(s) 113
FaiI YATR 1 cut(s) 65
FalI AAGNNNNNCTT 2 cut(s) 171, 203
FokI GGATG 1 cut(s) 80
HphI GGTGA 2 cut(s) 22, 217
Hpy188I TCNGA 2 cut(s) 70, 253
Hpy188III TCNNGA 1 cut(s) 112
HpyAV CCTTC 2 cut(s) 24, 245
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 40
Kzo9I GATC 2 cut(s) 70, 103
LpnPI CCDG 8 cut(s) 73, 99, 114, 125, 156, 212, 243, 256
LweI GCATC 1 cut(s) 236
MaeIII GTNAC 1 cut(s) 201
MalI GATC 2 cut(s) 72, 105
MboI GATC 2 cut(s) 70, 103
MboII GAAGA 2 cut(s) 100, 191
MnlI CCTC 6 cut(s) 59, 65, 90, 107, 110, 233
MseI TTAA 1 cut(s) 207
MwoI GCNNNNNNNGC 1 cut(s) 19
NdeII GATC 2 cut(s) 70, 103
NmuCI GTSAC 1 cut(s) 201
SaqAI TTAA 1 cut(s) 207
Sau3AI GATC 2 cut(s) 70, 103
SetI ASST 4 cut(s) 46, 57, 138, 159
SfaNI GCATC 1 cut(s) 236
SsiI CCGC 1 cut(s) 11
SspI AATATT 1 cut(s) 211
TaqI TCGA 1 cut(s) 102
Tru1I TTAA 1 cut(s) 207
Tru9I TTAA 1 cut(s) 207
TseFI GTSAC 1 cut(s) 201
Tsp45I GTSAC 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.