MD12G1257800.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0018723
Physical Location & Seq
Reverse (-)
32484181 .. 32485920
1740 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1257800.v1.1.491

Sequence Viewer

Length: 264 bp
ATGAGAACTCCGCCTTCACTGCTATCTCTCACCATTGACTCAGCTCTCCTCAACCTCCCCAGCATATCCGATCTCTCTCCTCTCCCTGACCACATCCTCCTCGATCTCTTTCTGAAAACTTTGAGAGCTGGAAAGCTAAATGAGAAAGTGTTGAATCTGTTTGTAGCCACTGGCAAGGATGAAGTCCTTTCATTAATCCAATCACTTAATATTCGGCAGACCCTCACCCCTGTGCTTCCTACCAGGTGCTCTGAAAAGTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

9.61

Weight (kDa)

7.92

Isoelectric Point (pI)

49.06

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0018723)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G30390
malus_domestica MD04G1240900.v1.1 MD12G1257800.v1.1
rosa_chinensis RchiOBHm_Chr3g0448311
rosa_multiflora Rmu_sc0005582.1_g000006 Rmu_sc0015167.1_g000004
rosa_samantha Rh3AG009900 Rh3BG009500 Rh3CG009400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 11
AgsI TTSAA 1 cut(s) 154
AjnI CCWGG 1 cut(s) 242
AleI CACNNNNGTG 1 cut(s) 230
AluBI AGCT 3 cut(s) 44, 128, 136
AluI AGCT 3 cut(s) 44, 128, 136
Alw21I GWGCWC 1 cut(s) 251
AseI ATTAAT 1 cut(s) 194
AsuHPI GGTGA 2 cut(s) 22, 217
Bbv12I GWGCWC 1 cut(s) 251
BciT130I CCWGG 1 cut(s) 244
Bme1390I CCNGG 1 cut(s) 244
BmrFI CCNGG 1 cut(s) 244
Bse1I ACTGG 1 cut(s) 175
BseBI CCWGG 1 cut(s) 244
BseGI GGATG 2 cut(s) 93, 184
BseMII CTCAG 1 cut(s) 54
BseNI ACTGG 1 cut(s) 175
BseRI GAGGAG 3 cut(s) 38, 69, 89
BseYI CCCAGC 1 cut(s) 59
BsiHKAI GWGCWC 1 cut(s) 251
Bsp1286I GDGCHC 1 cut(s) 251
Bsp143I GATC 2 cut(s) 70, 103
BspACI CCGC 1 cut(s) 11
BspCNI CTCAG 1 cut(s) 53
BsrI ACTGG 1 cut(s) 175
BssMI GATC 2 cut(s) 70, 103
Bst2UI CCWGG 1 cut(s) 244
BstDEI CTNAG 1 cut(s) 40
BstF5I GGATG 2 cut(s) 93, 184
BstKTI GATC 2 cut(s) 73, 106
BstMBI GATC 2 cut(s) 70, 103
BstMWI GCNNNNNNNGC 1 cut(s) 19
BstNI CCWGG 1 cut(s) 244
BstSCI CCNGG 1 cut(s) 242
BtsCI GGATG 2 cut(s) 93, 184
BtsI GCAGTG 1 cut(s) 17
BtsIMutI CAGTG 2 cut(s) 17, 168
CsiI ACCWGGT 1 cut(s) 242
CviJI RGCY 4 cut(s) 44, 128, 136, 167
CviKI_1 RGCY 4 cut(s) 44, 128, 136, 167
DdeI CTNAG 1 cut(s) 40
DpnI GATC 2 cut(s) 72, 105
DpnII GATC 2 cut(s) 70, 103
EcoRII CCWGG 1 cut(s) 242
FaiI YATR 1 cut(s) 65
FokI GGATG 2 cut(s) 80, 191
GsaI CCCAGC 1 cut(s) 63
HinfI GANTC 2 cut(s) 38, 154
HphI GGTGA 2 cut(s) 22, 217
Hpy188I TCNGA 3 cut(s) 70, 114, 253
HpyAV CCTTC 1 cut(s) 24
HpyF10VI GCNNNNNNNGC 1 cut(s) 19
HpyF3I CTNAG 1 cut(s) 40
Kzo9I GATC 2 cut(s) 70, 103
LpnPI CCDG 7 cut(s) 73, 99, 114, 156, 229, 243, 256
MabI ACCWGGT 1 cut(s) 242
MalI GATC 2 cut(s) 72, 105
MboI GATC 2 cut(s) 70, 103
MhlI GDGCHC 1 cut(s) 251
MlyI GAGTC 1 cut(s) 32
MnlI CCTC 6 cut(s) 59, 65, 90, 107, 110, 233
MseI TTAA 2 cut(s) 194, 207
MslI CAYNNNNRTG 1 cut(s) 230
MspR9I CCNGG 1 cut(s) 244
MvaI CCWGG 1 cut(s) 244
MwoI GCNNNNNNNGC 1 cut(s) 19
NdeII GATC 2 cut(s) 70, 103
OliI CACNNNNGTG 1 cut(s) 230
PfeI GAWTC 1 cut(s) 154
PleI GAGTC 1 cut(s) 32
PpsI GAGTC 1 cut(s) 32
PshBI ATTAAT 1 cut(s) 194
Psp6I CCWGG 1 cut(s) 242
PspFI CCCAGC 1 cut(s) 59
PspGI CCWGG 1 cut(s) 242
RseI CAYNNNNRTG 1 cut(s) 230
SaqAI TTAA 2 cut(s) 194, 207
Sau3AI GATC 2 cut(s) 70, 103
SchI GAGTC 1 cut(s) 32
ScrFI CCNGG 1 cut(s) 244
SduI GDGCHC 1 cut(s) 251
SetI ASST 5 cut(s) 46, 57, 130, 138, 248
SexAI ACCWGGT 1 cut(s) 242
SgeI CNNG 9 cut(s) 72, 98, 113, 141, 183, 187, 242, 255, 256
SmiMI CAYNNNNRTG 1 cut(s) 230
SsiI CCGC 1 cut(s) 11
SspI AATATT 1 cut(s) 211
StyD4I CCNGG 1 cut(s) 242
TaqI TCGA 1 cut(s) 102
TfiI GAWTC 1 cut(s) 154
Tru1I TTAA 2 cut(s) 194, 207
Tru9I TTAA 2 cut(s) 194, 207
TscAI CASTG 2 cut(s) 24, 175
TspDTI ATGAA 2 cut(s) 180, 195
TspRI CASTG 2 cut(s) 24, 175
VspI ATTAAT 1 cut(s) 194
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.