Rh3AG009900

UDP-arabinopyranose mutase

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Forward (+)
618801 .. 620377
1577 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG009900.1

Sequence Viewer

Length: 276 bp
ATGAATGAGTGTATGAGAACTCCGCCTTCTCTGCTATCTCTATCTATTGACTCAGCTCTACTCAACATCTCCAGTATCTCCGATCTCTCTCCTCTCCCTGACCACATAATCTGCGATCTCTTCTTGAAAACTTTGAGTGCTGGAAAGCTGAATGAGAAAGTCTTGAAGCTATTCATAGCAACTGGCAAGGATGAAGTCCTTTCACTAATTGAGGCACTTAATATTCGACAGATCCATAGTCCTGTCCTTCCTACCAGATGTTCTGAAAAGTTCTGA

Protein Analysis

91

Amino Acids

10.02

Weight (kDa)

6.04

Isoelectric Point (pI)

60.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018723)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 23
AclWI GGATC 1 cut(s) 226
AgsI TTSAA 2 cut(s) 127, 166
AluBI AGCT 3 cut(s) 56, 148, 169
AluI AGCT 3 cut(s) 56, 148, 169
AlwI GGATC 1 cut(s) 226
Asp700I GAANNNNTTC 1 cut(s) 170
BpmI CTGGAG 1 cut(s) 55
Bse1I ACTGG 2 cut(s) 72, 187
BseGI GGATG 1 cut(s) 196
BseMII CTCAG 1 cut(s) 66
BseNI ACTGG 2 cut(s) 72, 187
BseRI GAGGAG 1 cut(s) 81
Bsp143I GATC 3 cut(s) 82, 115, 231
BspACI CCGC 1 cut(s) 23
BspCNI CTCAG 1 cut(s) 65
BspPI GGATC 1 cut(s) 226
BsrI ACTGG 2 cut(s) 72, 187
BssMI GATC 3 cut(s) 82, 115, 231
Bst6I CTCTTC 1 cut(s) 125
BstDEI CTNAG 1 cut(s) 52
BstF5I GGATG 1 cut(s) 196
BstKTI GATC 3 cut(s) 85, 118, 234
BstMBI GATC 3 cut(s) 82, 115, 231
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstX2I RGATCY 1 cut(s) 231
BstYI RGATCY 1 cut(s) 231
BtsCI GGATG 1 cut(s) 196
CviJI RGCY 3 cut(s) 56, 148, 169
CviKI_1 RGCY 3 cut(s) 56, 148, 169
DdeI CTNAG 1 cut(s) 52
DpnI GATC 3 cut(s) 84, 117, 233
DpnII GATC 3 cut(s) 82, 115, 231
Eam1104I CTCTTC 1 cut(s) 125
EarI CTCTTC 1 cut(s) 125
EciI GGCGGA 1 cut(s) 12
FaiI YATR 4 cut(s) 14, 107, 176, 237
FokI GGATG 1 cut(s) 203
GsuI CTGGAG 1 cut(s) 55
HinfI GANTC 1 cut(s) 50
Hpy188I TCNGA 3 cut(s) 82, 265, 275
Hpy188III TCNNGA 2 cut(s) 124, 163
HpyAV CCTTC 2 cut(s) 36, 257
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 1 cut(s) 52
Kzo9I GATC 3 cut(s) 82, 115, 231
LpnPI CCDG 6 cut(s) 85, 111, 126, 168, 255, 268
MalI GATC 3 cut(s) 84, 117, 233
MboI GATC 3 cut(s) 82, 115, 231
MboII GAAGA 1 cut(s) 112
MflI RGATCY 1 cut(s) 231
MluCI AATT 1 cut(s) 207
MlyI GAGTC 1 cut(s) 44
MnlI CCTC 2 cut(s) 102, 205
MroXI GAANNNNTTC 1 cut(s) 170
MseI TTAA 1 cut(s) 219
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 3 cut(s) 82, 115, 231
PdmI GAANNNNTTC 1 cut(s) 170
PleI GAGTC 1 cut(s) 44
PpsI GAGTC 1 cut(s) 44
PsuI RGATCY 1 cut(s) 231
SaqAI TTAA 1 cut(s) 219
Sau3AI GATC 3 cut(s) 82, 115, 231
SchI GAGTC 1 cut(s) 44
SetI ASST 3 cut(s) 58, 150, 171
SgeI CNNG 9 cut(s) 84, 110, 136, 153, 175, 195, 199, 254, 267
Sse9I AATT 1 cut(s) 207
SsiI CCGC 1 cut(s) 23
SspI AATATT 1 cut(s) 223
TaqI TCGA 1 cut(s) 226
TasI AATT 1 cut(s) 207
Tru1I TTAA 1 cut(s) 219
Tru9I TTAA 1 cut(s) 219
TspDTI ATGAA 3 cut(s) 17, 163, 207
XmnI GAANNNNTTC 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.