MD05G1180300.v1.1

Domain of unknown function (DUF2828)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0018512
Physical Location & Seq
Forward (+)
30799024 .. 30799350
327 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1180300.v1.1.491

Sequence Viewer

Length: 327 bp
ATGGTGGAGGTCTACTTAAAGGAGGGGAAGCTGAAGAATTGGTTGGCTGTGTGTGATGTCGACAACACCTTGTCGGCGGGTTTGGCTTTAGGGCTTTTGTTGCCTCAATTGAGTGACGAGCCGTGGAAAGGAAAGGTGATCGCTTGCAGCAAAAACCCTCGGCTGCATTCGATACAAGGCGAGGATCTTAATTTGAGGGCCAAATATATGCAGACTTTGATCAAAAGCCAGGACTGGACGGCTGATTTCGGGAAGGTGTTCGATGTGATTCAAGAAGGTGCTTGCCTTGACCACATGCAAACACTTCTTGACAGGCAGCAACTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2828

Protein Analysis

109

Amino Acids

12.17

Weight (kDa)

5.58

Isoelectric Point (pI)

26.41

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF7788 PF25043 21 - 95 3.6e-12 Domain of unknown function (DUF7788)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 2 cut(s) 12, 60
AciI CCGC 1 cut(s) 77
AclWI GGATC 1 cut(s) 192
AcuI CTGAAG 1 cut(s) 53
AfiI CCNNNNNNNGG 1 cut(s) 128
AgsI TTSAA 1 cut(s) 272
AjnI CCWGG 1 cut(s) 228
AjuI GAANNNNNNNTTGG 2 cut(s) 26, 58
AluBI AGCT 1 cut(s) 31
AluI AGCT 1 cut(s) 31
AlwI GGATC 1 cut(s) 192
AoxI GGCC 1 cut(s) 198
ApeKI GCWGC 3 cut(s) 147, 163, 316
Asp700I GAANNNNTTC 1 cut(s) 257
AspS9I GGNCC 1 cut(s) 198
AsuHPI GGTGA 1 cut(s) 148
BbvI GCAGC 2 cut(s) 150, 159
BceAI ACGGC 2 cut(s) 106, 255
BciT130I CCWGG 1 cut(s) 230
BclI TGATCA 1 cut(s) 219
BisI GCNGC 3 cut(s) 148, 164, 317
BlsI GCNGC 3 cut(s) 149, 165, 318
Bme1390I CCNGG 1 cut(s) 230
BmgT120I GGNCC 1 cut(s) 198
BmrFI CCNGG 1 cut(s) 230
BsaJI CCNNGG 2 cut(s) 122, 158
Bsc4I CCNNNNNNNGG 1 cut(s) 128
Bse1I ACTGG 1 cut(s) 239
BseBI CCWGG 1 cut(s) 230
BseDI CCNNGG 2 cut(s) 122, 158
BseLI CCNNNNNNNGG 1 cut(s) 128
BseNI ACTGG 1 cut(s) 239
BseXI GCAGC 2 cut(s) 150, 159
BshFI GGCC 1 cut(s) 200
BslI CCNNNNNNNGG 1 cut(s) 128
BsmI GAATGC 1 cut(s) 166
BsnI GGCC 1 cut(s) 200
Bsp143I GATC 3 cut(s) 138, 184, 219
BspACI CCGC 1 cut(s) 77
BspANI GGCC 1 cut(s) 200
BspPI GGATC 1 cut(s) 192
BsrI ACTGG 1 cut(s) 239
BssECI CCNNGG 2 cut(s) 122, 158
BssMI GATC 3 cut(s) 138, 184, 219
Bst2UI CCWGG 1 cut(s) 230
BstC8I GCNNGC 2 cut(s) 145, 283
BstDSI CCRYGG 1 cut(s) 122
BstKTI GATC 3 cut(s) 141, 187, 222
BstMBI GATC 3 cut(s) 138, 184, 219
BstMWI GCNNNNNNNGC 2 cut(s) 83, 100
BstNI CCWGG 1 cut(s) 230
BstNSI RCATGY 1 cut(s) 298
BstSCI CCNGG 1 cut(s) 228
BstV1I GCAGC 2 cut(s) 150, 159
BstX2I RGATCY 1 cut(s) 184
BstYI RGATCY 1 cut(s) 184
BsuRI GGCC 1 cut(s) 200
BtgI CCRYGG 1 cut(s) 122
Cac8I GCNNGC 2 cut(s) 145, 283
Cfr13I GGNCC 1 cut(s) 198
CviAII CATG 1 cut(s) 295
CviJI RGCY 9 cut(s) 31, 47, 86, 94, 121, 163, 200, 228, 242
CviKI_1 RGCY 9 cut(s) 31, 47, 86, 94, 121, 163, 200, 228, 242
DpnI GATC 3 cut(s) 140, 186, 221
DpnII GATC 3 cut(s) 138, 184, 219
Eco57I CTGAAG 1 cut(s) 53
EcoRII CCWGG 1 cut(s) 228
FaeI CATG 1 cut(s) 298
FaiI YATR 3 cut(s) 207, 209, 296
FatI CATG 1 cut(s) 294
FauI CCCGC 1 cut(s) 70
FbaI TGATCA 1 cut(s) 219
FblI GTMKAC 2 cut(s) 12, 60
Fnu4HI GCNGC 3 cut(s) 148, 164, 317
Fsp4HI GCNGC 3 cut(s) 148, 164, 317
GluI GCNGC 3 cut(s) 148, 164, 317
HaeIII GGCC 1 cut(s) 200
Hin1II CATG 1 cut(s) 298
HincII GTYRAC 1 cut(s) 61
HindII GTYRAC 1 cut(s) 61
HinfI GANTC 1 cut(s) 268
HphI GGTGA 1 cut(s) 148
Hpy166II GTNNAC 2 cut(s) 13, 61
Hpy188III TCNNGA 3 cut(s) 250, 272, 308
Hpy8I GTNNAC 2 cut(s) 13, 61
HpyAV CCTTC 2 cut(s) 247, 269
HpyCH4V TGCA 4 cut(s) 147, 166, 211, 298
HpyF10VI GCNNNNNNNGC 2 cut(s) 83, 100
Hsp92II CATG 1 cut(s) 298
Ksp22I TGATCA 1 cut(s) 219
Kzo9I GATC 3 cut(s) 138, 184, 219
LpnPI CCDG 4 cut(s) 215, 220, 242, 298
Lsp1109I GCAGC 2 cut(s) 150, 159
MaeIII GTNAC 1 cut(s) 113
MalI GATC 3 cut(s) 140, 186, 221
MboI GATC 3 cut(s) 138, 184, 219
MboII GAAGA 1 cut(s) 46
MfeI CAATTG 1 cut(s) 107
MflI RGATCY 1 cut(s) 184
MluCI AATT 3 cut(s) 37, 107, 190
MnlI CCTC 5 cut(s) 16, 114, 168, 175, 189
MroXI GAANNNNTTC 1 cut(s) 257
MseI TTAA 2 cut(s) 17, 189
MspR9I CCNGG 1 cut(s) 230
MunI CAATTG 1 cut(s) 107
Mva1269I GAATGC 1 cut(s) 166
MvaI CCWGG 1 cut(s) 230
MwoI GCNNNNNNNGC 2 cut(s) 83, 100
NdeII GATC 3 cut(s) 138, 184, 219
NlaIII CATG 1 cut(s) 298
NmeAIII GCCGAG 1 cut(s) 139
NmuCI GTSAC 1 cut(s) 113
NspI RCATGY 1 cut(s) 298
PctI GAATGC 1 cut(s) 166
PdmI GAANNNNTTC 1 cut(s) 257
PfeI GAWTC 1 cut(s) 268
PkrI GCNGC 3 cut(s) 149, 165, 318
Psp6I CCWGG 1 cut(s) 228
PspGI CCWGG 1 cut(s) 228
PspPI GGNCC 1 cut(s) 198
PsuI RGATCY 1 cut(s) 184
SalI GTCGAC 1 cut(s) 59
SaqAI TTAA 2 cut(s) 17, 189
SatI GCNGC 3 cut(s) 148, 164, 317
Sau3AI GATC 3 cut(s) 138, 184, 219
Sau96I GGNCC 1 cut(s) 198
ScrFI CCNGG 1 cut(s) 230
SetI ASST 6 cut(s) 12, 33, 71, 138, 258, 280
Sse9I AATT 3 cut(s) 37, 107, 190
SsiI CCGC 1 cut(s) 77
StyD4I CCNGG 1 cut(s) 228
TaqI TCGA 3 cut(s) 60, 170, 261
TasI AATT 3 cut(s) 37, 107, 190
TfiI GAWTC 1 cut(s) 268
Tru1I TTAA 2 cut(s) 17, 189
Tru9I TTAA 2 cut(s) 17, 189
TseFI GTSAC 1 cut(s) 113
TseI GCWGC 3 cut(s) 147, 163, 316
Tsp45I GTSAC 1 cut(s) 113
XceI RCATGY 1 cut(s) 298
XmiI GTMKAC 2 cut(s) 12, 60
XmnI GAANNNNTTC 1 cut(s) 257
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.