MD06G1233900.v1.1

Serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0021121
Physical Location & Seq
Forward (+)
36511234 .. 36511782
549 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1233900.v1.1.491

Sequence Viewer

Length: 441 bp
ATGGGTTGCTGTGAATCCAAAGTTTCAGAGAACCAACAACCAGAGAAAATCCAAACCCAGCATCTAGCTCACAACAGCTGGACCCCAACCCACCACACAAATCCCACATCTGGATCCGACCTGGAAATTGGCGGAGCCCTACCCTTCTCCGAGTTCTCCTTTGCTGACCTCAAAGCCGCCACCAATAACTTCAGCTCTGACTACATAGTTTCGGAGAGCGGCGAGAAGGCCCCTAATCTTGTTTACAAGGGCTGGCTACAGAACCGTTGTTGGATCGCCGTTAAGAAGTTCACTAAGATGGCGTGGCCTGATCCCAAGCAGTTTGCGGAGGAAGCTTGGGGCGTGGGGAAGCTGCGGCATCGGCGGCTTGCGAATTTGATTGGGTATTGTTGTGATGGGGATGAGAGATGTGTGAGGGAGAGAGGGAGAGAGAGAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

147

Amino Acids

16.55

Weight (kDa)

7.64

Isoelectric Point (pI)

33.71

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021121)

Species Orthologous Gene IDs
malus_domestica MD06G1233900.v1.1 MD10G1128800.v1.1
pyrus_communis pycom06g20850
rosa_multiflora Rmu_co8288077.1_g000001 Rmu_sc0007137.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 219
AciI CCGC 6 cut(s) 132, 177, 219, 326, 355, 364
AclWI GGATC 4 cut(s) 108, 121, 281, 305
AcsI RAATTY 1 cut(s) 373
AcuI CTGAAG 1 cut(s) 175
AfiI CCNNNNNNNGG 1 cut(s) 110
AjnI CCWGG 1 cut(s) 120
AluBI AGCT 5 cut(s) 68, 78, 195, 335, 352
AluI AGCT 5 cut(s) 68, 78, 195, 335, 352
AlwI GGATC 4 cut(s) 108, 121, 281, 305
AoxI GGCC 2 cut(s) 228, 305
ApeKI GCWGC 1 cut(s) 352
ApoI RAATTY 1 cut(s) 373
AspS9I GGNCC 2 cut(s) 81, 229
AvaII GGWCC 1 cut(s) 81
BamHI GGATCC 1 cut(s) 113
BanII GRGCYC 1 cut(s) 139
BbvI GCAGC 1 cut(s) 339
BccI CCATC 2 cut(s) 292, 389
BceAI ACGGC 1 cut(s) 263
BciT130I CCWGG 1 cut(s) 122
BfaI CTAG 1 cut(s) 65
BfmI CTRYAG 1 cut(s) 257
BisI GCNGC 5 cut(s) 177, 220, 353, 356, 365
BlsI GCNGC 5 cut(s) 178, 221, 354, 357, 366
Bme1390I CCNGG 1 cut(s) 122
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 2 cut(s) 81, 229
BmiI GGNNCC 4 cut(s) 83, 115, 136, 231
BmrFI CCNGG 1 cut(s) 122
BmsI GCATC 2 cut(s) 70, 367
Bsc4I CCNNNNNNNGG 1 cut(s) 110
BseBI CCWGG 1 cut(s) 122
BseGI GGATG 1 cut(s) 406
BseLI CCNNNNNNNGG 1 cut(s) 110
BseXI GCAGC 1 cut(s) 339
BseYI CCCAGC 1 cut(s) 57
BshFI GGCC 2 cut(s) 230, 307
BslI CCNNNNNNNGG 1 cut(s) 110
BsnI GGCC 2 cut(s) 230, 307
Bsp1286I GDGCHC 1 cut(s) 139
Bsp143I GATC 3 cut(s) 113, 273, 310
BspACI CCGC 6 cut(s) 132, 177, 219, 326, 355, 364
BspANI GGCC 2 cut(s) 230, 307
BspLI GGNNCC 4 cut(s) 83, 115, 136, 231
BspPI GGATC 4 cut(s) 108, 121, 281, 305
BsrBI CCGCTC 1 cut(s) 219
BssMI GATC 3 cut(s) 113, 273, 310
Bst2UI CCWGG 1 cut(s) 122
Bst4CI ACNGT 1 cut(s) 266
BstC8I GCNNGC 2 cut(s) 254, 369
BstDEI CTNAG 1 cut(s) 294
BstF5I GGATG 1 cut(s) 406
BstKTI GATC 3 cut(s) 116, 276, 313
BstMBI GATC 3 cut(s) 113, 273, 310
BstMWI GCNNNNNNNGC 3 cut(s) 332, 361, 364
BstNI CCWGG 1 cut(s) 122
BstSCI CCNGG 1 cut(s) 120
BstSFI CTRYAG 1 cut(s) 257
BstV1I GCAGC 1 cut(s) 339
BstX2I RGATCY 1 cut(s) 113
BstYI RGATCY 1 cut(s) 113
BsuRI GGCC 2 cut(s) 230, 307
BtsCI GGATG 1 cut(s) 406
Cac8I GCNNGC 2 cut(s) 254, 369
Cfr13I GGNCC 2 cut(s) 81, 229
DdeI CTNAG 1 cut(s) 294
DpnI GATC 3 cut(s) 115, 275, 312
DpnII GATC 3 cut(s) 113, 273, 310
EciI GGCGGA 1 cut(s) 147
Eco24I GRGCYC 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 175
EcoO109I RGGNCCY 1 cut(s) 229
EcoRII CCWGG 1 cut(s) 120
EcoT38I GRGCYC 1 cut(s) 139
FaiI YATR 1 cut(s) 206
Fnu4HI GCNGC 5 cut(s) 177, 220, 353, 356, 365
FokI GGATG 1 cut(s) 413
FriOI GRGCYC 1 cut(s) 139
Fsp4HI GCNGC 5 cut(s) 177, 220, 353, 356, 365
FspBI CTAG 1 cut(s) 65
GluI GCNGC 5 cut(s) 177, 220, 353, 356, 365
GsaI CCCAGC 1 cut(s) 61
HaeIII GGCC 2 cut(s) 230, 307
HindIII AAGCTT 1 cut(s) 333
HinfI GANTC 1 cut(s) 14
Hpy166II GTNNAC 2 cut(s) 244, 291
Hpy188I TCNGA 5 cut(s) 28, 118, 151, 199, 214
Hpy188III TCNNGA 1 cut(s) 111
Hpy8I GTNNAC 2 cut(s) 244, 291
HpyAV CCTTC 2 cut(s) 154, 220
HpyCH4III ACNGT 1 cut(s) 266
HpyF10VI GCNNNNNNNGC 3 cut(s) 332, 361, 364
HpyF3I CTNAG 1 cut(s) 294
Kzo9I GATC 3 cut(s) 113, 273, 310
LmnI GCTCC 1 cut(s) 134
LpnPI CCDG 8 cut(s) 54, 64, 71, 96, 107, 134, 238, 321
Lsp1109I GCAGC 1 cut(s) 339
LweI GCATC 2 cut(s) 70, 367
MaeI CTAG 1 cut(s) 65
MalI GATC 3 cut(s) 115, 275, 312
MbiI CCGCTC 1 cut(s) 219
MboI GATC 3 cut(s) 113, 273, 310
MflI RGATCY 1 cut(s) 113
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 3 cut(s) 126, 373, 436
MmeI TCCRAC 2 cut(s) 141, 251
MnlI CCTC 4 cut(s) 179, 322, 408, 416
MseI TTAA 1 cut(s) 282
MslI CAYNNNNRTG 1 cut(s) 296
MspA1I CMGCKG 1 cut(s) 78
MspR9I CCNGG 1 cut(s) 122
MvaI CCWGG 1 cut(s) 122
MwoI GCNNNNNNNGC 3 cut(s) 332, 361, 364
NdeII GATC 3 cut(s) 113, 273, 310
NlaIV GGNNCC 4 cut(s) 83, 115, 136, 231
PfeI GAWTC 1 cut(s) 14
PkrI GCNGC 5 cut(s) 178, 221, 354, 357, 366
Psp6I CCWGG 1 cut(s) 120
PspFI CCCAGC 1 cut(s) 57
PspGI CCWGG 1 cut(s) 120
PspN4I GGNNCC 4 cut(s) 83, 115, 136, 231
PspPI GGNCC 2 cut(s) 81, 229
PsuI RGATCY 1 cut(s) 113
PvuII CAGCTG 1 cut(s) 78
RseI CAYNNNNRTG 1 cut(s) 296
SaqAI TTAA 1 cut(s) 282
SatI GCNGC 5 cut(s) 177, 220, 353, 356, 365
Sau3AI GATC 3 cut(s) 113, 273, 310
Sau96I GGNCC 2 cut(s) 81, 229
ScrFI CCNGG 1 cut(s) 122
SduI GDGCHC 1 cut(s) 139
SetI ASST 7 cut(s) 70, 80, 123, 171, 197, 337, 354
SfaNI GCATC 2 cut(s) 70, 367
SfcI CTRYAG 1 cut(s) 257
SinI GGWCC 1 cut(s) 81
SmiMI CAYNNNNRTG 1 cut(s) 296
Sse9I AATT 3 cut(s) 126, 373, 436
SsiI CCGC 6 cut(s) 132, 177, 219, 326, 355, 364
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 1 cut(s) 120
TaaI ACNGT 1 cut(s) 266
TasI AATT 3 cut(s) 126, 373, 436
TauI GCSGC 4 cut(s) 179, 222, 358, 367
TfiI GAWTC 1 cut(s) 14
Tru1I TTAA 1 cut(s) 282
Tru9I TTAA 1 cut(s) 282
TseI GCWGC 1 cut(s) 352
VpaK11BI GGWCC 1 cut(s) 81
XapI RAATTY 1 cut(s) 373
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.