MD10G1128800.v1.1

Serine threonine-protein kinase

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
OG0021121
Physical Location & Seq
Forward (+)
20936988 .. 20937439
452 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1128800.v1.1.491

Sequence Viewer

Length: 339 bp
ATGGGTTGCTGTGAATCCAAAGTTTCAGAGAACCAACAACCAGAGAAAATCCAAACCCAGCATCTAGCTCACAACAGCCGGACCACGACCCACCACACGAATCCCACCTCCGAATCCGACCTGGAAACCGGCGGAGCCCCACCCTTCTCCGAATTCTCCTTCACCGACCTCAAAGCCGCCACCAACAACTTCAGCTCTGACTACATAGTATCGGAGAGCGGCGAGAAGGCCCCTAATCTTGTTTACCAGGGCCGGCTGCAGAACCGCTGTTGGATCGCCGTCAAGAAGTTCACCAAGATGGCGTGGCCTGATCCCAAGCAGTTTGCGGAGGAAGCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04075 map04075
Pfam Domains
Protein Families
Pkinase Pkinase_Tyr

Protein Analysis

113

Amino Acids

12.54

Weight (kDa)

5.76

Isoelectric Point (pI)

39.97

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021121)

Species Orthologous Gene IDs
malus_domestica MD06G1233900.v1.1 MD10G1128800.v1.1
pyrus_communis pycom06g20850
rosa_multiflora Rmu_co8288077.1_g000001 Rmu_sc0007137.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 219
AciI CCGC 5 cut(s) 132, 177, 219, 265, 326
AclWI GGATC 2 cut(s) 281, 305
AcsI RAATTY 1 cut(s) 152
AcuI CTGAAG 1 cut(s) 175
AjnI CCWGG 2 cut(s) 120, 246
AluBI AGCT 3 cut(s) 68, 195, 335
AluI AGCT 3 cut(s) 68, 195, 335
AlwI GGATC 2 cut(s) 281, 305
AoxI GGCC 3 cut(s) 228, 250, 305
ApeKI GCWGC 1 cut(s) 256
ApoI RAATTY 1 cut(s) 152
AspS9I GGNCC 3 cut(s) 81, 229, 250
AsuHPI GGTGA 2 cut(s) 154, 283
AvaII GGWCC 1 cut(s) 81
BanII GRGCYC 1 cut(s) 139
BbvI GCAGC 1 cut(s) 243
BccI CCATC 1 cut(s) 292
BceAI ACGGC 1 cut(s) 263
BciT130I CCWGG 2 cut(s) 122, 248
BfaI CTAG 1 cut(s) 65
BfmI CTRYAG 1 cut(s) 257
BisI GCNGC 3 cut(s) 177, 220, 257
BlsI GCNGC 3 cut(s) 178, 221, 258
Bme1390I CCNGG 2 cut(s) 122, 248
Bme18I GGWCC 1 cut(s) 81
BmgT120I GGNCC 3 cut(s) 81, 229, 250
BmiI GGNNCC 2 cut(s) 136, 231
BmrFI CCNGG 2 cut(s) 122, 248
BmsI GCATC 1 cut(s) 70
BsaJI CCNNGG 1 cut(s) 247
Bse118I RCCGGY 2 cut(s) 128, 252
BseBI CCWGG 2 cut(s) 122, 248
BseDI CCNNGG 1 cut(s) 247
BseXI GCAGC 1 cut(s) 243
BseYI CCCAGC 1 cut(s) 57
BshFI GGCC 3 cut(s) 230, 252, 307
BsiSI CCGG 3 cut(s) 79, 129, 253
BsnI GGCC 3 cut(s) 230, 252, 307
Bsp1286I GDGCHC 1 cut(s) 139
Bsp143I GATC 2 cut(s) 273, 310
BspACI CCGC 5 cut(s) 132, 177, 219, 265, 326
BspANI GGCC 3 cut(s) 230, 252, 307
BspLI GGNNCC 2 cut(s) 136, 231
BspMAI CTGCAG 1 cut(s) 261
BspPI GGATC 2 cut(s) 281, 305
BsrBI CCGCTC 1 cut(s) 219
BsrFI RCCGGY 2 cut(s) 128, 252
BssAI RCCGGY 2 cut(s) 128, 252
BssECI CCNNGG 1 cut(s) 247
BssMI GATC 2 cut(s) 273, 310
Bst2UI CCWGG 2 cut(s) 122, 248
BstC8I GCNNGC 1 cut(s) 254
BstDEI CTNAG 1 cut(s) 336
BstKTI GATC 2 cut(s) 276, 313
BstMBI GATC 2 cut(s) 273, 310
BstMWI GCNNNNNNNGC 1 cut(s) 332
BstNI CCWGG 2 cut(s) 122, 248
BstSCI CCNGG 2 cut(s) 120, 246
BstSFI CTRYAG 1 cut(s) 257
BstV1I GCAGC 1 cut(s) 243
BsuRI GGCC 3 cut(s) 230, 252, 307
Cac8I GCNNGC 1 cut(s) 254
Cfr10I RCCGGY 2 cut(s) 128, 252
Cfr13I GGNCC 3 cut(s) 81, 229, 250
DdeI CTNAG 1 cut(s) 336
DpnI GATC 2 cut(s) 275, 312
DpnII GATC 2 cut(s) 273, 310
EciI GGCGGA 1 cut(s) 147
Eco24I GRGCYC 1 cut(s) 139
Eco47I GGWCC 1 cut(s) 81
Eco57I CTGAAG 1 cut(s) 175
EcoO109I RGGNCCY 1 cut(s) 229
EcoRI GAATTC 1 cut(s) 152
EcoRII CCWGG 2 cut(s) 120, 246
EcoT38I GRGCYC 1 cut(s) 139
FaiI YATR 1 cut(s) 206
Fnu4HI GCNGC 3 cut(s) 177, 220, 257
FriOI GRGCYC 1 cut(s) 139
Fsp4HI GCNGC 3 cut(s) 177, 220, 257
FspBI CTAG 1 cut(s) 65
GluI GCNGC 3 cut(s) 177, 220, 257
GsaI CCCAGC 1 cut(s) 61
HaeIII GGCC 3 cut(s) 230, 252, 307
HapII CCGG 3 cut(s) 79, 129, 253
HindIII AAGCTT 1 cut(s) 333
HinfI GANTC 3 cut(s) 14, 100, 113
HpaII CCGG 3 cut(s) 79, 129, 253
HphI GGTGA 2 cut(s) 154, 283
Hpy166II GTNNAC 2 cut(s) 244, 291
Hpy188I TCNGA 6 cut(s) 28, 112, 118, 151, 199, 214
Hpy188III TCNNGA 1 cut(s) 283
Hpy8I GTNNAC 2 cut(s) 244, 291
HpyAV CCTTC 3 cut(s) 154, 169, 220
HpyCH4V TGCA 1 cut(s) 259
HpyF10VI GCNNNNNNNGC 1 cut(s) 332
HpyF3I CTNAG 1 cut(s) 336
KroI GCCGGC 1 cut(s) 252
KroNI GCCGGC 1 cut(s) 254
Kzo9I GATC 2 cut(s) 273, 310
LmnI GCTCC 1 cut(s) 134
Lsp1109I GCAGC 1 cut(s) 243
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 65
MalI GATC 2 cut(s) 275, 312
MbiI CCGCTC 1 cut(s) 219
MboI GATC 2 cut(s) 273, 310
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 1 cut(s) 152
MmeI TCCRAC 2 cut(s) 141, 251
MnlI CCTC 3 cut(s) 118, 179, 322
MroNI GCCGGC 1 cut(s) 252
MslI CAYNNNNRTG 1 cut(s) 296
MspA1I CMGCKG 1 cut(s) 267
MspI CCGG 3 cut(s) 79, 129, 253
MspR9I CCNGG 2 cut(s) 122, 248
MvaI CCWGG 2 cut(s) 122, 248
MwoI GCNNNNNNNGC 1 cut(s) 332
NaeI GCCGGC 1 cut(s) 254
NdeII GATC 2 cut(s) 273, 310
NgoMIV GCCGGC 1 cut(s) 252
NlaIV GGNNCC 2 cut(s) 136, 231
PdiI GCCGGC 1 cut(s) 254
PfeI GAWTC 3 cut(s) 14, 100, 113
PkrI GCNGC 3 cut(s) 178, 221, 258
Psp6I CCWGG 2 cut(s) 120, 246
PspFI CCCAGC 1 cut(s) 57
PspGI CCWGG 2 cut(s) 120, 246
PspN4I GGNNCC 2 cut(s) 136, 231
PspPI GGNCC 3 cut(s) 81, 229, 250
PstI CTGCAG 1 cut(s) 261
RseI CAYNNNNRTG 1 cut(s) 296
SatI GCNGC 3 cut(s) 177, 220, 257
Sau3AI GATC 2 cut(s) 273, 310
Sau96I GGNCC 3 cut(s) 81, 229, 250
ScrFI CCNGG 2 cut(s) 122, 248
SduI GDGCHC 1 cut(s) 139
SetI ASST 6 cut(s) 70, 110, 123, 171, 197, 337
SfaNI GCATC 1 cut(s) 70
SfcI CTRYAG 1 cut(s) 257
SinI GGWCC 1 cut(s) 81
SmiMI CAYNNNNRTG 1 cut(s) 296
Sse9I AATT 1 cut(s) 152
SsiI CCGC 5 cut(s) 132, 177, 219, 265, 326
SspMI CTAG 1 cut(s) 65
StyD4I CCNGG 2 cut(s) 120, 246
TasI AATT 1 cut(s) 152
TauI GCSGC 2 cut(s) 179, 222
TfiI GAWTC 3 cut(s) 14, 100, 113
TseI GCWGC 1 cut(s) 256
VpaK11BI GGWCC 1 cut(s) 81
XapI RAATTY 1 cut(s) 152
XspI CTAG 1 cut(s) 65
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.