MD08G1003300.v1.1

U3 small nucleolar RNA-associated protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr08
Physical Location & Seq
Reverse (-)
353331 .. 354375
1045 bp
Loading structure...
UTR
Exon/CDS
Intron
MD08G1003300.v1.1.491

Sequence Viewer

Length: 297 bp
ATGCTTTGCCATCAAATTGTCAGTGGCTTCTGCCAAGTGAGGGAGGTTGCTTGGAGGCAGAAGGCAATGAGAAGACATGGAGATTTTGGTCCATACACATTGGATTTCACCTCAAGTAGTCGGTATATAGTGATTGGTGGGCGCAAGGGTCATCTGGCTATTGTAGACTTGATGAATACGAGGCTGGTTAAAAAATTTCAGGTTGGGGAAACAGTGCGTGATGTTGTGTTCTTGGACACTCATCTCATGAGTTCTTTGCTGCAGCCCAGGAAAAGTATGAGACTGTTTGCCATTTAA

Protein Analysis

99

Amino Acids

11.3

Weight (kDa)

10.36

Isoelectric Point (pI)

23.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022393)

Species Orthologous Gene IDs
malus_domestica MD08G1003300.v1.1
rosa_chinensis RchiOBHm_Chr1g0336791 RchiOBHm_Chr4g0414881
rosa_samantha Rh5BG159400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 165
AcsI RAATTY 1 cut(s) 194
AfiI CCNNNNNNNGG 1 cut(s) 40
AjnI CCWGG 1 cut(s) 266
Alw26I GTCTC 1 cut(s) 274
ApeKI GCWGC 2 cut(s) 259, 262
ApoI RAATTY 1 cut(s) 194
AspLEI GCGC 1 cut(s) 144
AspS9I GGNCC 1 cut(s) 89
AsuHPI GGTGA 1 cut(s) 100
AvaII GGWCC 1 cut(s) 89
BbsI GAAGAC 1 cut(s) 79
BbvI GCAGC 2 cut(s) 246, 274
BccI CCATC 1 cut(s) 18
BciT130I CCWGG 1 cut(s) 268
BcoDI GTCTC 1 cut(s) 274
BfmI CTRYAG 1 cut(s) 260
BisI GCNGC 2 cut(s) 260, 263
BlsI GCNGC 2 cut(s) 261, 264
Bme1390I CCNGG 1 cut(s) 268
Bme18I GGWCC 1 cut(s) 89
BmgT120I GGNCC 1 cut(s) 89
BmrFI CCNGG 1 cut(s) 268
BpiI GAAGAC 1 cut(s) 79
BpuEI CTTGAG 1 cut(s) 97
BsaJI CCNNGG 1 cut(s) 266
Bsc4I CCNNNNNNNGG 1 cut(s) 40
Bse3DI GCAATG 1 cut(s) 72
BseBI CCWGG 1 cut(s) 268
BseDI CCNNGG 1 cut(s) 266
BseLI CCNNNNNNNGG 1 cut(s) 40
BseMI GCAATG 1 cut(s) 72
BseXI GCAGC 2 cut(s) 246, 274
BslI CCNNNNNNNGG 1 cut(s) 40
BsmAI GTCTC 1 cut(s) 274
BspHI TCATGA 1 cut(s) 246
BspMAI CTGCAG 1 cut(s) 264
BsrDI GCAATG 1 cut(s) 72
BssECI CCNNGG 1 cut(s) 266
Bst2UI CCWGG 1 cut(s) 268
Bst4CI ACNGT 2 cut(s) 214, 285
BstHHI GCGC 1 cut(s) 144
BstMAI GTCTC 1 cut(s) 274
BstNI CCWGG 1 cut(s) 268
BstSCI CCNGG 1 cut(s) 266
BstSFI CTRYAG 1 cut(s) 260
BstV1I GCAGC 2 cut(s) 246, 274
BstV2I GAAGAC 1 cut(s) 79
BtsIMutI CAGTG 2 cut(s) 28, 219
CciI TCATGA 1 cut(s) 246
CfoI GCGC 1 cut(s) 144
Cfr13I GGNCC 1 cut(s) 89
CviAII CATG 2 cut(s) 77, 247
CviJI RGCY 4 cut(s) 27, 158, 184, 265
CviKI_1 RGCY 4 cut(s) 27, 158, 184, 265
Eco47I GGWCC 1 cut(s) 89
EcoRII CCWGG 1 cut(s) 266
FaeI CATG 2 cut(s) 80, 250
FaiI YATR 6 cut(s) 78, 94, 126, 128, 248, 278
FatI CATG 2 cut(s) 76, 246
FblI GTMKAC 1 cut(s) 165
Fnu4HI GCNGC 2 cut(s) 260, 263
Fsp4HI GCNGC 2 cut(s) 260, 263
GlaI GCGC 1 cut(s) 143
GluI GCNGC 2 cut(s) 260, 263
HhaI GCGC 1 cut(s) 144
Hin1II CATG 2 cut(s) 80, 250
Hin6I GCGC 1 cut(s) 142
HinP1I GCGC 1 cut(s) 142
HphI GGTGA 1 cut(s) 100
Hpy166II GTNNAC 1 cut(s) 166
Hpy188III TCNNGA 1 cut(s) 247
Hpy8I GTNNAC 1 cut(s) 166
HpyAV CCTTC 1 cut(s) 55
HpyCH4III ACNGT 2 cut(s) 214, 285
HpyCH4V TGCA 1 cut(s) 262
Hsp92II CATG 2 cut(s) 80, 250
HspAI GCGC 1 cut(s) 142
LpnPI CCDG 5 cut(s) 140, 170, 185, 253, 280
Lsp1109I GCAGC 2 cut(s) 246, 274
MboII GAAGA 1 cut(s) 84
MluCI AATT 2 cut(s) 15, 194
MnlI CCTC 5 cut(s) 33, 37, 48, 121, 174
MseI TTAA 2 cut(s) 189, 295
MspR9I CCNGG 1 cut(s) 268
MvaI CCWGG 1 cut(s) 268
NlaIII CATG 2 cut(s) 80, 250
PagI TCATGA 1 cut(s) 246
PkrI GCNGC 2 cut(s) 261, 264
Psp6I CCWGG 1 cut(s) 266
PspGI CCWGG 1 cut(s) 266
PspPI GGNCC 1 cut(s) 89
PstI CTGCAG 1 cut(s) 264
SaqAI TTAA 2 cut(s) 189, 295
SatI GCNGC 2 cut(s) 260, 263
Sau96I GGNCC 1 cut(s) 89
ScrFI CCNGG 1 cut(s) 268
SetI ASST 3 cut(s) 48, 113, 204
SfcI CTRYAG 1 cut(s) 260
SinI GGWCC 1 cut(s) 89
SmlI CTYRAG 1 cut(s) 112
SmoI CTYRAG 1 cut(s) 112
Sse9I AATT 2 cut(s) 15, 194
StyD4I CCNGG 1 cut(s) 266
TaaI ACNGT 2 cut(s) 214, 285
TasI AATT 2 cut(s) 15, 194
Tru1I TTAA 2 cut(s) 189, 295
Tru9I TTAA 2 cut(s) 189, 295
TscAI CASTG 2 cut(s) 28, 219
TseI GCWGC 2 cut(s) 259, 262
TspDTI ATGAA 1 cut(s) 188
TspRI CASTG 2 cut(s) 28, 219
VpaK11BI GGWCC 1 cut(s) 89
XapI RAATTY 1 cut(s) 194
XmiI GTMKAC 1 cut(s) 165
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.