RchiOBHm_Chr4g0414881

U3 small nucleolar RNA-associated protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
39395433 .. 39399361
3929 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38521

Sequence Viewer

Length: 144 bp
ATGGCTGGATTCACGCCAAGTGGTCGATACATGATGGTTGGTGGACACAAGGGTCATCTAGCTATTGTAGACATGAAGCAAATAAGCCTGATTAAAGAATTTCAGGAGGTTGAGTATTCTGGTGGTGGCATTCCTCTATATTGA

Protein Analysis

47

Amino Acids

5.14

Weight (kDa)

6.7

Isoelectric Point (pI)

32.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0022393)

Species Orthologous Gene IDs
malus_domestica MD08G1003300.v1.1
rosa_chinensis RchiOBHm_Chr1g0336791 RchiOBHm_Chr4g0414881
rosa_samantha Rh5BG159400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 51
AccI GTMKAC 1 cut(s) 69
AcsI RAATTY 1 cut(s) 98
AluBI AGCT 1 cut(s) 62
AluI AGCT 1 cut(s) 62
ApoI RAATTY 1 cut(s) 98
BccI CCATC 1 cut(s) 28
BfaI CTAG 1 cut(s) 59
BsaXI ACNNNNNCTCC 2 cut(s) 98, 128
BsmI GAATGC 1 cut(s) 129
CviAII CATG 2 cut(s) 31, 73
CviJI RGCY 3 cut(s) 5, 62, 87
CviKI_1 RGCY 3 cut(s) 5, 62, 87
DrdI GACNNNNNNGTC 1 cut(s) 51
DseDI GACNNNNNNGTC 1 cut(s) 51
FaeI CATG 2 cut(s) 34, 76
FaiI YATR 3 cut(s) 32, 74, 139
FatI CATG 2 cut(s) 30, 72
FblI GTMKAC 1 cut(s) 69
FspBI CTAG 1 cut(s) 59
Hin1II CATG 2 cut(s) 34, 76
HinfI GANTC 1 cut(s) 9
Hpy166II GTNNAC 2 cut(s) 44, 70
Hpy188III TCNNGA 1 cut(s) 104
Hpy8I GTNNAC 2 cut(s) 44, 70
Hsp92II CATG 2 cut(s) 34, 76
LpnPI CCDG 3 cut(s) 89, 101, 105
MaeI CTAG 1 cut(s) 59
MluCI AATT 1 cut(s) 98
MnlI CCTC 2 cut(s) 100, 144
MseI TTAA 1 cut(s) 93
Mva1269I GAATGC 1 cut(s) 129
NlaIII CATG 2 cut(s) 34, 76
PctI GAATGC 1 cut(s) 129
PfeI GAWTC 1 cut(s) 9
SaqAI TTAA 1 cut(s) 93
SetI ASST 2 cut(s) 64, 111
Sse9I AATT 1 cut(s) 98
SspMI CTAG 1 cut(s) 59
TaqI TCGA 1 cut(s) 25
TasI AATT 1 cut(s) 98
TfiI GAWTC 1 cut(s) 9
Tru1I TTAA 1 cut(s) 93
Tru9I TTAA 1 cut(s) 93
TspDTI ATGAA 1 cut(s) 89
XapI RAATTY 1 cut(s) 98
XmiI GTMKAC 1 cut(s) 69
XspI CTAG 1 cut(s) 59
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.