MD09G1098000.v1.1

Component of the cytochrome b6-f complex, which mediates electron transfer between photosystem II (PSII) and photosystem I (PSI), cyclic electron flow around PSI, and state transitions

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0020230
Physical Location & Seq
Reverse (-)
7126931 .. 7127197
267 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1098000.v1.1.491

Sequence Viewer

Length: 267 bp
ATGTCCCCCTTTTCCTTATTCTATTTTATTAGCCGAAAGGTATTTTGGCTTGGTGTCCACTTGGTCACAAATCCAACACGTCCCACCAGAAAACATATTATTGTGATAGGTCCAATTATTGGTAAAAAATATAGTGAAATTACATTTTCTATTCTTTTCTCAGACCTTGCTACTAAAAAATATGTGCACTTCTTAAAATATCCCATGTATGTACCCAAGAATAGGAGAATGGATCAGATTTATCTCGACGGGAGAAAAAAATTATAA

Protein Analysis

89

Amino Acids

10.5

Weight (kDa)

10.33

Isoelectric Point (pI)

47.44

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Apocytochr_F_N PF16639 22 - 75 4.4e-10 Apocytochrome F, N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020230)

Species Orthologous Gene IDs
arabidopsis_thaliana ATCG00540
malus_domestica MD09G1098000.v1.1 MD12G1014500.v1.1
pyrus_communis pycom12397g00220
rosa_chinensis RchiOBHm_CPg0502071
rosa_rugosa Rorug02G0490700

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 265
AccB7I CCANNNNNTGG 1 cut(s) 119
AclWI GGATC 1 cut(s) 240
AfaI GTAC 1 cut(s) 213
AfiI CCNNNNNNNGG 2 cut(s) 119, 222
AflIII ACRYGT 1 cut(s) 77
AjiI CACGTC 1 cut(s) 80
AjuI GAANNNNNNNTTGG 2 cut(s) 28, 60
Alw21I GWGCWC 1 cut(s) 189
Alw44I GTGCAC 1 cut(s) 185
AlwI GGATC 1 cut(s) 240
ApaLI GTGCAC 1 cut(s) 185
AspS9I GGNCC 1 cut(s) 110
AvaII GGWCC 1 cut(s) 110
BaeGI GKGCMC 1 cut(s) 189
Bbv12I GWGCWC 1 cut(s) 189
Bme18I GGWCC 1 cut(s) 110
BmgBI CACGTC 1 cut(s) 80
BmgT120I GGNCC 1 cut(s) 110
Bsc4I CCNNNNNNNGG 2 cut(s) 119, 222
BseLI CCNNNNNNNGG 2 cut(s) 119, 222
BseMII CTCAG 1 cut(s) 174
BseSI GKGCMC 1 cut(s) 189
BsiHKAI GWGCWC 1 cut(s) 189
BslFI GGGAC 1 cut(s) 66
BslI CCNNNNNNNGG 2 cut(s) 119, 222
BsmFI GGGAC 1 cut(s) 66
Bsp1286I GDGCHC 1 cut(s) 189
Bsp143I GATC 1 cut(s) 232
BspCNI CTCAG 1 cut(s) 173
BspPI GGATC 1 cut(s) 240
BssMI GATC 1 cut(s) 232
BstDEI CTNAG 1 cut(s) 160
BstKTI GATC 1 cut(s) 235
BstMBI GATC 1 cut(s) 232
BstSLI GKGCMC 1 cut(s) 189
BtrI CACGTC 1 cut(s) 80
Cfr13I GGNCC 1 cut(s) 110
Csp6I GTAC 1 cut(s) 212
CviAII CATG 1 cut(s) 205
CviJI RGCY 2 cut(s) 33, 49
CviKI_1 RGCY 2 cut(s) 33, 49
CviQI GTAC 1 cut(s) 212
DdeI CTNAG 1 cut(s) 160
DpnI GATC 1 cut(s) 234
DpnII GATC 1 cut(s) 232
Eco47I GGWCC 1 cut(s) 110
FaeI CATG 1 cut(s) 208
FaiI YATR 6 cut(s) 96, 132, 183, 206, 210, 265
FaqI GGGAC 1 cut(s) 66
FatI CATG 1 cut(s) 204
Hin1II CATG 1 cut(s) 208
Hpy166II GTNNAC 2 cut(s) 58, 187
Hpy188I TCNGA 2 cut(s) 163, 237
Hpy188III TCNNGA 1 cut(s) 245
Hpy8I GTNNAC 2 cut(s) 58, 187
Hpy99I CGWCG 1 cut(s) 251
HpyCH4IV ACGT 1 cut(s) 79
HpyCH4V TGCA 1 cut(s) 187
HpyF3I CTNAG 1 cut(s) 160
HpySE526I ACGT 1 cut(s) 79
Hsp92II CATG 1 cut(s) 208
Kzo9I GATC 1 cut(s) 232
LpnPI CCDG 1 cut(s) 100
MaeII ACGT 1 cut(s) 79
MaeIII GTNAC 1 cut(s) 64
MalI GATC 1 cut(s) 234
MboI GATC 1 cut(s) 232
MhlI GDGCHC 1 cut(s) 189
MluCI AATT 3 cut(s) 114, 138, 260
MmeI TCCRAC 1 cut(s) 98
MseI TTAA 1 cut(s) 194
NdeII GATC 1 cut(s) 232
NlaIII CATG 1 cut(s) 208
NmuCI GTSAC 1 cut(s) 64
PflMI CCANNNNNTGG 1 cut(s) 119
PsiI TTATAA 1 cut(s) 265
PspPI GGNCC 1 cut(s) 110
RsaI GTAC 1 cut(s) 213
RsaNI GTAC 1 cut(s) 212
SaqAI TTAA 1 cut(s) 194
Sau3AI GATC 1 cut(s) 232
Sau96I GGNCC 1 cut(s) 110
SduI GDGCHC 1 cut(s) 189
SetI ASST 4 cut(s) 42, 82, 112, 168
SgeI CNNG 9 cut(s) 62, 73, 90, 99, 179, 217, 229, 257, 262
SinI GGWCC 1 cut(s) 110
Sse9I AATT 3 cut(s) 114, 138, 260
TaiI ACGT 1 cut(s) 82
TaqI TCGA 1 cut(s) 246
TasI AATT 3 cut(s) 114, 138, 260
Tru1I TTAA 1 cut(s) 194
Tru9I TTAA 1 cut(s) 194
TseFI GTSAC 1 cut(s) 64
Tsp45I GTSAC 1 cut(s) 64
Van91I CCANNNNNTGG 1 cut(s) 119
VneI GTGCAC 1 cut(s) 185
VpaK11BI GGWCC 1 cut(s) 110
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.