MD09G1247900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
31786722 .. 31788029
1308 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1247900.v1.1.491

Sequence Viewer

Length: 240 bp
ATGAACAAGCCAGGCTTTTTAGCGGCCTCTGTCGCCGCCGCTTCTGCCACTGCTCTCTCCGTCTCCGCCACTCCTTCTTCTTCTTCTTCAAGCTTTGTGTCTGATTCAACCATGCGATTTTCTCACCAGGAGACTGGGTGTAAGAGAAATCAAGCAAAATCATCGGCTTCGACCGAGAAATTTGCGCCCAAGTTCGATGGGTTGAGATTTATTGAAACACTGGTTACTGCTCATAGATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.29

Weight (kDa)

9.86

Isoelectric Point (pI)

48.85

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019575)

Species Orthologous Gene IDs
arabidopsis_thaliana AT4G28290 AT4G28290
malus_domestica MD09G1247900.v1.1 MD17G1240800.v1.1
prunus_persica Prupe.3G137400_v2.0.a1
pyrus_communis pycom09g16540 pycom17g24400

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 4 cut(s) 23, 36, 39, 66
AcsI RAATTY 1 cut(s) 179
AgsI TTSAA 3 cut(s) 90, 108, 215
AjnI CCWGG 2 cut(s) 10, 126
AluBI AGCT 1 cut(s) 93
AluI AGCT 1 cut(s) 93
Alw26I GTCTC 2 cut(s) 67, 125
AoxI GGCC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 179
AspLEI GCGC 1 cut(s) 187
AsuHPI GGTGA 1 cut(s) 116
BccI CCATC 1 cut(s) 191
BcgI CGANNNNNNTGC 4 cut(s) 144, 164, 178, 198
BciT130I CCWGG 2 cut(s) 12, 128
BcoDI GTCTC 2 cut(s) 67, 125
BisI GCNGC 3 cut(s) 24, 36, 39
BlsI GCNGC 3 cut(s) 25, 37, 40
Bme1390I CCNGG 2 cut(s) 12, 128
BmrFI CCNGG 2 cut(s) 12, 128
BmrI ACTGGG 1 cut(s) 144
BmuI ACTGGG 1 cut(s) 144
BsaXI ACNNNNNCTCC 2 cut(s) 122, 152
Bse1I ACTGG 2 cut(s) 139, 225
BseBI CCWGG 2 cut(s) 12, 128
BseNI ACTGG 2 cut(s) 139, 225
Bsh1285I CGRYCG 1 cut(s) 174
BshFI GGCC 1 cut(s) 26
BsiEI CGRYCG 1 cut(s) 174
BsmAI GTCTC 2 cut(s) 67, 125
BsmBI CGTCTC 1 cut(s) 67
BsnI GGCC 1 cut(s) 26
BspACI CCGC 4 cut(s) 23, 36, 39, 66
BspANI GGCC 1 cut(s) 26
BsrI ACTGG 2 cut(s) 139, 225
Bst2UI CCWGG 2 cut(s) 12, 128
BstHHI GCGC 1 cut(s) 187
BstMAI GTCTC 2 cut(s) 67, 125
BstMCI CGRYCG 1 cut(s) 174
BstMWI GCNNNNNNNGC 2 cut(s) 32, 44
BstNI CCWGG 2 cut(s) 12, 128
BstSCI CCNGG 2 cut(s) 10, 126
BstXI CCANNNNNNTGG 1 cut(s) 134
BsuRI GGCC 1 cut(s) 26
BtsI GCAGTG 1 cut(s) 48
BtsIMutI CAGTG 2 cut(s) 48, 218
CfoI GCGC 1 cut(s) 187
CviAII CATG 1 cut(s) 112
CviJI RGCY 5 cut(s) 10, 15, 26, 93, 167
CviKI_1 RGCY 5 cut(s) 10, 15, 26, 93, 167
EciI GGCGGA 1 cut(s) 55
EcoRII CCWGG 2 cut(s) 10, 126
Esp3I CGTCTC 1 cut(s) 67
FaeI CATG 1 cut(s) 115
FaiI YATR 2 cut(s) 113, 234
FalI AAGNNNNNCTT 1 cut(s) 31
FatI CATG 1 cut(s) 111
Fnu4HI GCNGC 3 cut(s) 24, 36, 39
Fsp4HI GCNGC 3 cut(s) 24, 36, 39
GlaI GCGC 1 cut(s) 186
GluI GCNGC 3 cut(s) 24, 36, 39
HaeIII GGCC 1 cut(s) 26
HhaI GCGC 1 cut(s) 187
Hin1II CATG 1 cut(s) 115
Hin6I GCGC 1 cut(s) 185
HinP1I GCGC 1 cut(s) 185
HindIII AAGCTT 1 cut(s) 91
HinfI GANTC 1 cut(s) 104
HphI GGTGA 1 cut(s) 116
Hpy188I TCNGA 1 cut(s) 103
HpyAV CCTTC 1 cut(s) 84
HpyF10VI GCNNNNNNNGC 2 cut(s) 32, 44
Hsp92II CATG 1 cut(s) 115
HspAI GCGC 1 cut(s) 185
LpnPI CCDG 5 cut(s) 24, 113, 120, 140, 206
MaeIII GTNAC 1 cut(s) 223
MboII GAAGA 4 cut(s) 69, 72, 75, 78
MluCI AATT 1 cut(s) 179
MnlI CCTC 1 cut(s) 37
MspR9I CCNGG 2 cut(s) 12, 128
MvaI CCWGG 2 cut(s) 12, 128
MwoI GCNNNNNNNGC 2 cut(s) 32, 44
NlaIII CATG 1 cut(s) 115
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 3 cut(s) 25, 37, 40
Psp6I CCWGG 2 cut(s) 10, 126
PspGI CCWGG 2 cut(s) 10, 126
SatI GCNGC 3 cut(s) 24, 36, 39
ScrFI CCNGG 2 cut(s) 12, 128
SetI ASST 1 cut(s) 95
Sse9I AATT 1 cut(s) 179
SsiI CCGC 4 cut(s) 23, 36, 39, 66
StyD4I CCNGG 2 cut(s) 10, 126
TaqI TCGA 2 cut(s) 170, 195
TaqII GACCGA 1 cut(s) 188
TasI AATT 1 cut(s) 179
TauI GCSGC 3 cut(s) 26, 38, 41
TfiI GAWTC 1 cut(s) 104
TscAI CASTG 2 cut(s) 55, 225
TspDTI ATGAA 1 cut(s) 17
TspGWI ACGGA 1 cut(s) 49
TspRI CASTG 2 cut(s) 55, 225
XapI RAATTY 1 cut(s) 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.