MD10G1240900.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr10
Physical Location & Seq
Forward (+)
33642599 .. 33643718
1120 bp
Loading structure...
UTR
Exon/CDS
Intron
MD10G1240900.v1.1.491

Sequence Viewer

Length: 486 bp
ATGTTTTCTCCAACGATGAGTTTCAAAATGGGACTGATTCATTGTTGCTTGTTGTTGTGTCTGATCGTTATGGTAGCCAATCATGTTGAAGCACGTCAGCAGCCTACAGAGATTCCAAAACAGGTTGAGGAGGAGCAAACCAAGGGAAAACCCCTAGGAGGAAGTGGTAATGATCAAAGTGAAGGAAAGGTGATGGAGCAGTCCTCAGGAAAGGCAAAGATGGATGAGTTGGGTGAGATGAAGAATTTGCCACCACTTCCTAATATTCCCATTCCACCCCAATTCCCATTGCCGCCCCAAATTCCTGGCTTTCCAATTCCACAATTCCCGTTTCCACCCCAAATTCCTGGCCTTCCAATTCCGCAATTCCCCTTCCCACCCCCATTTGAGATTCCTAATGCCCCTCCATTCCCATCAATTCCCAATTTCCCATTCCCTCCTTTTAATATTCCTAATATCCCCCTCTTTTCACCTCCTCCTGCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

162

Amino Acids

17.64

Weight (kDa)

5.3

Isoelectric Point (pI)

91.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018815)

Species Orthologous Gene IDs
fragaria_vesca FvH4_3g11531
malus_domestica MD10G1240900.v1.1
prunus_persica Prupe.4G102700_v2.0.a1
rosa_chinensis RchiOBHm_Chr5g0018481
rosa_laevigata RLG00000032370
rosa_roxburghii Rroxscaffold_1G00059250
rosa_rugosa Rorug05G0044500
rosa_samantha Rh5CG146700 Rh5DG135800

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 293, 362
AcsI RAATTY 3 cut(s) 244, 300, 342
AfiI CCNNNNNNNGG 1 cut(s) 158
AgsI TTSAA 2 cut(s) 25, 89
AjiI CACGTC 1 cut(s) 95
AjnI CCWGG 2 cut(s) 304, 346
AjuI GAANNNNNNNTTGG 2 cut(s) 416, 448
AoxI GGCC 1 cut(s) 349
ApeKI GCWGC 1 cut(s) 100
ApoI RAATTY 3 cut(s) 244, 300, 342
AspA2I CCTAGG 1 cut(s) 154
AsuHPI GGTGA 3 cut(s) 202, 245, 462
AvrII CCTAGG 1 cut(s) 154
AxyI CCTNAGG 1 cut(s) 205
BbvI GCAGC 1 cut(s) 112
BccI CCATC 3 cut(s) 187, 214, 421
BciT130I CCWGG 2 cut(s) 306, 348
BclI TGATCA 1 cut(s) 172
BfaI CTAG 1 cut(s) 155
BfmI CTRYAG 1 cut(s) 105
BisI GCNGC 2 cut(s) 101, 293
BlnI CCTAGG 1 cut(s) 154
BlsI GCNGC 2 cut(s) 102, 294
Bme1390I CCNGG 2 cut(s) 306, 348
BmgBI CACGTC 1 cut(s) 95
BmrFI CCNGG 2 cut(s) 306, 348
BplI GAGNNNNNCTC 2 cut(s) 188, 220
BsaJI CCNNGG 2 cut(s) 141, 154
Bsc4I CCNNNNNNNGG 1 cut(s) 158
Bse21I CCTNAGG 1 cut(s) 205
Bse3DI GCAATG 1 cut(s) 287
BseBI CCWGG 2 cut(s) 306, 348
BseDI CCNNGG 2 cut(s) 141, 154
BseGI GGATG 1 cut(s) 229
BseLI CCNNNNNNNGG 1 cut(s) 158
BseMI GCAATG 1 cut(s) 287
BseMII CTCAG 1 cut(s) 219
BseRI GAGGAG 3 cut(s) 143, 146, 465
BseXI GCAGC 1 cut(s) 112
BshFI GGCC 1 cut(s) 351
BslFI GGGAC 1 cut(s) 45
BslI CCNNNNNNNGG 1 cut(s) 158
BsmFI GGGAC 1 cut(s) 45
BsnI GGCC 1 cut(s) 351
Bsp143I GATC 2 cut(s) 63, 172
BspACI CCGC 2 cut(s) 293, 362
BspANI GGCC 1 cut(s) 351
BspCNI CTCAG 1 cut(s) 218
BsrDI GCAATG 1 cut(s) 287
BssECI CCNNGG 2 cut(s) 141, 154
BssMI GATC 2 cut(s) 63, 172
BssT1I CCWWGG 2 cut(s) 141, 154
Bst2UI CCWGG 2 cut(s) 306, 348
BstDEI CTNAG 1 cut(s) 205
BstF5I GGATG 1 cut(s) 229
BstKTI GATC 2 cut(s) 66, 175
BstMBI GATC 2 cut(s) 63, 172
BstNI CCWGG 2 cut(s) 306, 348
BstSCI CCNGG 2 cut(s) 304, 346
BstSFI CTRYAG 1 cut(s) 105
BstV1I GCAGC 1 cut(s) 112
BstXI CCANNNNNNTGG 2 cut(s) 305, 347
Bsu36I CCTNAGG 1 cut(s) 205
BsuRI GGCC 1 cut(s) 351
BtrI CACGTC 1 cut(s) 95
BtsCI GGATG 1 cut(s) 229
CviAII CATG 1 cut(s) 83
CviJI RGCY 4 cut(s) 77, 103, 309, 351
CviKI_1 RGCY 4 cut(s) 77, 103, 309, 351
DdeI CTNAG 1 cut(s) 205
DpnI GATC 2 cut(s) 65, 174
DpnII GATC 2 cut(s) 63, 172
Eco130I CCWWGG 2 cut(s) 141, 154
Eco81I CCTNAGG 1 cut(s) 205
EcoRII CCWGG 2 cut(s) 304, 346
EcoT14I CCWWGG 2 cut(s) 141, 154
ErhI CCWWGG 2 cut(s) 141, 154
FaeI CATG 1 cut(s) 86
FaiI YATR 2 cut(s) 71, 84
FaqI GGGAC 1 cut(s) 45
FatI CATG 1 cut(s) 82
FbaI TGATCA 1 cut(s) 172
Fnu4HI GCNGC 2 cut(s) 101, 293
FokI GGATG 1 cut(s) 236
Fsp4HI GCNGC 2 cut(s) 101, 293
FspBI CTAG 1 cut(s) 155
GluI GCNGC 2 cut(s) 101, 293
HaeIII GGCC 1 cut(s) 351
Hin1II CATG 1 cut(s) 86
HinfI GANTC 3 cut(s) 37, 112, 391
HphI GGTGA 3 cut(s) 202, 245, 462
Hpy188I TCNGA 1 cut(s) 63
Hpy188III TCNNGA 1 cut(s) 207
HpyAV CCTTC 3 cut(s) 176, 362, 382
HpyCH4IV ACGT 1 cut(s) 94
HpyF3I CTNAG 1 cut(s) 205
HpySE526I ACGT 1 cut(s) 94
Hsp92II CATG 1 cut(s) 86
Ksp22I TGATCA 1 cut(s) 172
Kzo9I GATC 2 cut(s) 63, 172
LmnI GCTCC 2 cut(s) 133, 196
LpnPI CCDG 6 cut(s) 107, 192, 291, 318, 333, 360
Lsp1109I GCAGC 1 cut(s) 112
MaeI CTAG 1 cut(s) 155
MaeII ACGT 1 cut(s) 94
MalI GATC 2 cut(s) 65, 174
MboI GATC 2 cut(s) 63, 172
MboII GAAGA 1 cut(s) 253
MmeI TCCRAC 1 cut(s) 35
MnlI CCTC 9 cut(s) 121, 124, 152, 214, 414, 447, 473, 483, 486
MseI TTAA 2 cut(s) 444, 484
MspR9I CCNGG 2 cut(s) 306, 348
MvaI CCWGG 2 cut(s) 306, 348
NdeII GATC 2 cut(s) 63, 172
NlaIII CATG 1 cut(s) 86
PfeI GAWTC 3 cut(s) 37, 112, 391
PkrI GCNGC 2 cut(s) 102, 294
Psp6I CCWGG 2 cut(s) 304, 346
PspGI CCWGG 2 cut(s) 304, 346
SaqAI TTAA 2 cut(s) 444, 484
SatI GCNGC 2 cut(s) 101, 293
Sau3AI GATC 2 cut(s) 63, 172
ScrFI CCNGG 2 cut(s) 306, 348
SetI ASST 4 cut(s) 97, 126, 192, 475
SfcI CTRYAG 1 cut(s) 105
SsiI CCGC 2 cut(s) 293, 362
SspI AATATT 2 cut(s) 265, 448
SspMI CTAG 1 cut(s) 155
StyD4I CCNGG 2 cut(s) 304, 346
StyI CCWWGG 2 cut(s) 141, 154
TaiI ACGT 1 cut(s) 97
TauI GCSGC 1 cut(s) 295
TfiI GAWTC 3 cut(s) 37, 112, 391
Tru1I TTAA 2 cut(s) 444, 484
Tru9I TTAA 2 cut(s) 444, 484
TseI GCWGC 1 cut(s) 100
TspDTI ATGAA 2 cut(s) 29, 254
XapI RAATTY 3 cut(s) 244, 300, 342
XmaJI CCTAGG 1 cut(s) 154
XspI CTAG 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.