MD11G1003700.v1.1

Arabinogalactan peptide

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
305241 .. 305546
306 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1003700.v1.1.491

Sequence Viewer

Length: 189 bp
ATGGAGGCAATGAAGATGAACCTTTTTGTTGCTTTGTTGGTGGTTATGATGGTGGCCTTCTCAGGCATTCAACAAGTAGCTGCAGCTGCAGCTGAAGCTCCAGCTCCAAGCCCAACATCTGATGCCTTCACATTTGCCCCCACTTTCTTTGCTTCTCTGGCAGCTTTGGCTTTTGGCTTATTCTTCTAA

Protein Analysis

63

Amino Acids

6.45

Weight (kDa)

4.14

Isoelectric Point (pI)

41.75

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017923)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G55330 AT3G13520 AT4G26320 AT5G56540
malus_domestica MD03G1004000.v1.1 MD11G1003700.v1.1
prunus_persica Prupe.6G003500_v2.0.a1
pyrus_communis pycom03g00400
rosa_chinensis RchiOBHm_Chr5g0083751
rosa_roxburghii Rroxscaffold_1G00000830
rosa_wichuraiana Rw5G050100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 114
AgsI TTSAA 1 cut(s) 71
AluBI AGCT 6 cut(s) 80, 86, 92, 98, 104, 164
AluI AGCT 6 cut(s) 80, 86, 92, 98, 104, 164
AoxI GGCC 1 cut(s) 54
ApeKI GCWGC 5 cut(s) 80, 83, 86, 89, 161
BbvI GCAGC 5 cut(s) 67, 73, 95, 101, 173
BccI CCATC 1 cut(s) 43
BfmI CTRYAG 2 cut(s) 81, 87
BisI GCNGC 5 cut(s) 81, 84, 87, 90, 162
BlsI GCNGC 5 cut(s) 82, 85, 88, 91, 163
BmsI GCATC 1 cut(s) 112
BpmI CTGGAG 1 cut(s) 84
Bse3DI GCAATG 1 cut(s) 15
BseMI GCAATG 1 cut(s) 15
BseMII CTCAG 1 cut(s) 75
BseXI GCAGC 5 cut(s) 67, 73, 95, 101, 173
BshFI GGCC 1 cut(s) 56
BsmI GAATGC 1 cut(s) 66
BsnI GGCC 1 cut(s) 56
BspANI GGCC 1 cut(s) 56
BspCNI CTCAG 1 cut(s) 74
BspMAI CTGCAG 2 cut(s) 85, 91
BsrDI GCAATG 1 cut(s) 15
BstDEI CTNAG 1 cut(s) 61
BstMWI GCNNNNNNNGC 5 cut(s) 86, 89, 95, 158, 167
BstSFI CTRYAG 2 cut(s) 81, 87
BstV1I GCAGC 5 cut(s) 67, 73, 95, 101, 173
BsuRI GGCC 1 cut(s) 56
CspCI CAANNNNNGTGG 2 cut(s) 130, 165
DdeI CTNAG 1 cut(s) 61
Eco57I CTGAAG 1 cut(s) 114
FaiI YATR 1 cut(s) 47
Fnu4HI GCNGC 5 cut(s) 81, 84, 87, 90, 162
Fsp4HI GCNGC 5 cut(s) 81, 84, 87, 90, 162
GluI GCNGC 5 cut(s) 81, 84, 87, 90, 162
GsuI CTGGAG 1 cut(s) 84
HaeIII GGCC 1 cut(s) 56
Hpy188I TCNGA 1 cut(s) 121
HpyAV CCTTC 2 cut(s) 67, 136
HpyCH4V TGCA 2 cut(s) 83, 89
HpyF10VI GCNNNNNNNGC 5 cut(s) 86, 89, 95, 158, 167
HpyF3I CTNAG 1 cut(s) 61
LmnI GCTCC 2 cut(s) 103, 109
LpnPI CCDG 3 cut(s) 48, 114, 143
Lsp1109I GCAGC 5 cut(s) 67, 73, 95, 101, 173
LweI GCATC 1 cut(s) 112
MboII GAAGA 2 cut(s) 25, 175
MspA1I CMGCKG 2 cut(s) 86, 92
Mva1269I GAATGC 1 cut(s) 66
MwoI GCNNNNNNNGC 5 cut(s) 86, 89, 95, 158, 167
PctI GAATGC 1 cut(s) 66
PkrI GCNGC 5 cut(s) 82, 85, 88, 91, 163
PstI CTGCAG 2 cut(s) 85, 91
PvuII CAGCTG 2 cut(s) 86, 92
SatI GCNGC 5 cut(s) 81, 84, 87, 90, 162
SetI ASST 7 cut(s) 24, 82, 88, 94, 100, 106, 166
SfaNI GCATC 1 cut(s) 112
SfcI CTRYAG 2 cut(s) 81, 87
SgeI CNNG 5 cut(s) 75, 86, 113, 120, 170
TseI GCWGC 5 cut(s) 80, 83, 86, 89, 161
TspDTI ATGAA 2 cut(s) 26, 32
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.