Prupe.6G003500_v2.0.a1

Arabinogalactan peptide

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
379546 .. 380926
1381 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G003500.1

Sequence Viewer

Length: 183 bp
ATGGAGGCAATGAAGATGAATGCTTTTGTGGCTTTGTTGGTGGTTGTGATGGTGGCCTTGTCTGGCGTTCAAAAAGTAGCTGCAGCTGATTCTCCAGCACCAAGCCCAGCTTCTGATGCCTATGCCTTTGCCCCCACTTTCTTTGCATCTCTAGCAGCTTTGGCTTTTGGGTTCTTCTTCTGA

Protein Analysis

61

Amino Acids

6.18

Weight (kDa)

4.56

Isoelectric Point (pI)

52.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017923)

Species Orthologous Gene IDs
arabidopsis_thaliana AT1G55330 AT3G13520 AT4G26320 AT5G56540
malus_domestica MD03G1004000.v1.1 MD11G1003700.v1.1
prunus_persica Prupe.6G003500_v2.0.a1
pyrus_communis pycom03g00400
rosa_chinensis RchiOBHm_Chr5g0083751
rosa_roxburghii Rroxscaffold_1G00000830
rosa_wichuraiana Rw5G050100

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 71
AjuI GAANNNNNNNTTGG 2 cut(s) 94, 126
AluBI AGCT 4 cut(s) 80, 86, 110, 158
AluI AGCT 4 cut(s) 80, 86, 110, 158
AlwNI CAGNNNCTG 1 cut(s) 113
AoxI GGCC 1 cut(s) 54
ApeKI GCWGC 3 cut(s) 80, 83, 155
BbvI GCAGC 3 cut(s) 67, 95, 167
BccI CCATC 1 cut(s) 43
BfaI CTAG 1 cut(s) 152
BfmI CTRYAG 1 cut(s) 81
BisI GCNGC 3 cut(s) 81, 84, 156
BlsI GCNGC 3 cut(s) 82, 85, 157
BmsI GCATC 2 cut(s) 106, 155
BpmI CTGGAG 1 cut(s) 78
Bse3DI GCAATG 1 cut(s) 15
BseMI GCAATG 1 cut(s) 15
BseXI GCAGC 3 cut(s) 67, 95, 167
BseYI CCCAGC 1 cut(s) 106
BshFI GGCC 1 cut(s) 56
BsmI GAATGC 1 cut(s) 25
BsnI GGCC 1 cut(s) 56
BspANI GGCC 1 cut(s) 56
BspMAI CTGCAG 1 cut(s) 85
BsrDI GCAATG 1 cut(s) 15
BstMWI GCNNNNNNNGC 4 cut(s) 29, 116, 152, 161
BstSFI CTRYAG 1 cut(s) 81
BstV1I GCAGC 3 cut(s) 67, 95, 167
BsuRI GGCC 1 cut(s) 56
CaiI CAGNNNCTG 1 cut(s) 113
CspCI CAANNNNNGTGG 2 cut(s) 124, 159
CviJI RGCY 8 cut(s) 32, 56, 80, 86, 105, 110, 158, 164
CviKI_1 RGCY 8 cut(s) 32, 56, 80, 86, 105, 110, 158, 164
FaiI YATR 1 cut(s) 123
FalI AAGNNNNNCTT 2 cut(s) 94, 126
Fnu4HI GCNGC 3 cut(s) 81, 84, 156
Fsp4HI GCNGC 3 cut(s) 81, 84, 156
FspBI CTAG 1 cut(s) 152
GluI GCNGC 3 cut(s) 81, 84, 156
GsaI CCCAGC 1 cut(s) 110
GsuI CTGGAG 1 cut(s) 78
HaeIII GGCC 1 cut(s) 56
HinfI GANTC 1 cut(s) 89
Hpy188I TCNGA 2 cut(s) 115, 182
HpyCH4V TGCA 2 cut(s) 83, 146
HpyF10VI GCNNNNNNNGC 4 cut(s) 29, 116, 152, 161
LpnPI CCDG 3 cut(s) 48, 108, 120
Lsp1109I GCAGC 3 cut(s) 67, 95, 167
LweI GCATC 2 cut(s) 106, 155
MaeI CTAG 1 cut(s) 152
MboII GAAGA 3 cut(s) 25, 166, 169
MspA1I CMGCKG 1 cut(s) 86
Mva1269I GAATGC 1 cut(s) 25
MwoI GCNNNNNNNGC 4 cut(s) 29, 116, 152, 161
PctI GAATGC 1 cut(s) 25
PfeI GAWTC 1 cut(s) 89
PkrI GCNGC 3 cut(s) 82, 85, 157
PspFI CCCAGC 1 cut(s) 106
PstI CTGCAG 1 cut(s) 85
PstNI CAGNNNCTG 1 cut(s) 113
PvuII CAGCTG 1 cut(s) 86
SatI GCNGC 3 cut(s) 81, 84, 156
SetI ASST 4 cut(s) 82, 88, 112, 160
SfaNI GCATC 2 cut(s) 106, 155
SfcI CTRYAG 1 cut(s) 81
SgeI CNNG 6 cut(s) 70, 75, 107, 114, 119, 164
SspMI CTAG 1 cut(s) 152
TfiI GAWTC 1 cut(s) 89
TseI GCWGC 3 cut(s) 80, 83, 155
TspDTI ATGAA 2 cut(s) 26, 32
XspI CTAG 1 cut(s) 152
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.