MD11G1295100.v1.1

ATP synthase subunit beta

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
OG0021210
Physical Location & Seq
Forward (+)
41346056 .. 41346559
504 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1295100.v1.1.491

Sequence Viewer

Length: 504 bp
ATGAGAATAAATCCTACTACTTCTGGTCCTGGGGTTCCTGCACTTGAAAAAAAAAACTTGGGGCGTATCGCTCAAATCATTGGTCCGGTACTGGATGTAGCTTTTCCACCGGGCAAGATGCCTAATATTTACAACGTTCTGGTAGTTAGGGGTCGAGATGATGTTGGTCAACAAACTAATGTGACTTGTGAAGTACAACAATTATTAGGAAATAATCGAGTTAGAGTTGTAGCTATGAGTGCTACAGATGGTCTAAAGAGAGGAATGAAAGTGATTGACACCAGAGCTTCTCTAAGTGTTCCAGTCGGCGGAGCGACTCTAGGACGAATTTTCAACGTGCTTGGAGAGTCGGTTGATAATTTAGGTCTTGTAGATACTCACACAACATCTCCTATTCATAGATATGCACCTACCTTTATACAGTTAGATACAAAATTATCTATTTTTGAAACAGGAATTAAAGTAGTAGACCTTTTAGCCCCTTATCGTCGTGGAGGAAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko00190 ko00195 ko01100 map00190 map00195 map01100
Pfam Domains
Protein Families
ATP-synt_ab ATP-synt_ab_N

Protein Analysis

168

Amino Acids

17.94

Weight (kDa)

9.92

Isoelectric Point (pI)

28.08

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ATP-synt_ab_N PF02874 23 - 94 4.5e-21 ATP synthase alpha/beta family, beta-barrel domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0021210)

Species Orthologous Gene IDs
malus_domestica MD11G1295100.v1.1
rosa_chinensis RchiOBHm_Chr7g0228781 RchiOBHm_Chr7g0228791
rosa_roxburghii Rroxscaffold_4G00299650
rosa_samantha Rh7DG399500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 468
AciI CCGC 1 cut(s) 309
AclI AACGTT 1 cut(s) 135
AcsI RAATTY 1 cut(s) 327
AfaI GTAC 2 cut(s) 90, 195
AfiI CCNNNNNNNGG 1 cut(s) 308
AgsI TTSAA 3 cut(s) 47, 334, 449
AjnI CCWGG 1 cut(s) 28
AluBI AGCT 3 cut(s) 101, 233, 287
AluI AGCT 3 cut(s) 101, 233, 287
ApoI RAATTY 1 cut(s) 327
ArsI GACNNNNNNTTYG 2 cut(s) 67, 99
AspS9I GGNCC 2 cut(s) 26, 83
AsuC2I CCSGG 1 cut(s) 111
AvaII GGWCC 2 cut(s) 26, 83
BccI CCATC 1 cut(s) 242
BciT130I CCWGG 1 cut(s) 30
BcnI CCSGG 1 cut(s) 111
BfaI CTAG 1 cut(s) 320
BfmI CTRYAG 1 cut(s) 243
Bme1390I CCNGG 2 cut(s) 30, 111
Bme18I GGWCC 2 cut(s) 26, 83
BmgT120I GGNCC 2 cut(s) 26, 83
BmiI GGNNCC 1 cut(s) 36
BmrFI CCNGG 2 cut(s) 30, 111
BmsI GCATC 1 cut(s) 108
BpuMI CCSGG 1 cut(s) 111
BsaJI CCNNGG 1 cut(s) 29
BsaWI WCCGGW 1 cut(s) 85
BsaXI ACNNNNNCTCC 4 cut(s) 336, 366, 373, 403
Bsc4I CCNNNNNNNGG 1 cut(s) 308
Bse1I ACTGG 2 cut(s) 96, 302
BseBI CCWGG 1 cut(s) 30
BseDI CCNNGG 1 cut(s) 29
BseGI GGATG 1 cut(s) 100
BseLI CCNNNNNNNGG 1 cut(s) 308
BseNI ACTGG 2 cut(s) 96, 302
BsgI GTGCAG 1 cut(s) 24
BsiSI CCGG 2 cut(s) 86, 110
BslI CCNNNNNNNGG 1 cut(s) 308
BspACI CCGC 1 cut(s) 309
BspLI GGNNCC 1 cut(s) 36
BsrI ACTGG 2 cut(s) 96, 302
BssECI CCNNGG 1 cut(s) 29
Bst2UI CCWGG 1 cut(s) 30
Bst4CI ACNGT 1 cut(s) 423
BstDEI CTNAG 1 cut(s) 293
BstF5I GGATG 1 cut(s) 100
BstMWI GCNNNNNNNGC 1 cut(s) 239
BstNI CCWGG 1 cut(s) 30
BstSCI CCNGG 2 cut(s) 28, 109
BstSFI CTRYAG 1 cut(s) 243
BtsCI GGATG 1 cut(s) 100
Cfr13I GGNCC 2 cut(s) 26, 83
Csp6I GTAC 2 cut(s) 89, 194
CviJI RGCY 4 cut(s) 101, 233, 287, 479
CviKI_1 RGCY 4 cut(s) 101, 233, 287, 479
CviQI GTAC 2 cut(s) 89, 194
DdeI CTNAG 1 cut(s) 293
EciI GGCGGA 1 cut(s) 324
Eco47I GGWCC 2 cut(s) 26, 83
EcoRII CCWGG 1 cut(s) 28
FaiI YATR 4 cut(s) 236, 399, 405, 419
FblI GTMKAC 1 cut(s) 468
FokI GGATG 1 cut(s) 107
FspBI CTAG 1 cut(s) 320
HapII CCGG 2 cut(s) 86, 110
HincII GTYRAC 1 cut(s) 170
HindII GTYRAC 1 cut(s) 170
HinfI GANTC 2 cut(s) 316, 347
HpaII CCGG 2 cut(s) 86, 110
Hpy166II GTNNAC 2 cut(s) 170, 469
Hpy188III TCNNGA 1 cut(s) 155
Hpy8I GTNNAC 2 cut(s) 170, 469
Hpy99I CGWCG 1 cut(s) 492
HpyCH4III ACNGT 1 cut(s) 423
HpyCH4IV ACGT 2 cut(s) 135, 336
HpyCH4V TGCA 2 cut(s) 41, 407
HpyF10VI GCNNNNNNNGC 1 cut(s) 239
HpyF3I CTNAG 1 cut(s) 293
HpySE526I ACGT 2 cut(s) 135, 336
LmnI GCTCC 1 cut(s) 311
LweI GCATC 1 cut(s) 108
MaeI CTAG 1 cut(s) 320
MaeII ACGT 2 cut(s) 135, 336
MaeIII GTNAC 1 cut(s) 181
MluCI AATT 5 cut(s) 200, 327, 358, 434, 456
MlyI GAGTC 2 cut(s) 310, 356
MnlI CCTC 2 cut(s) 254, 488
MseI TTAA 1 cut(s) 459
MslI CAYNNNNRTG 1 cut(s) 402
MspI CCGG 2 cut(s) 86, 110
MspR9I CCNGG 2 cut(s) 30, 111
MvaI CCWGG 1 cut(s) 30
MwoI GCNNNNNNNGC 1 cut(s) 239
NciI CCSGG 1 cut(s) 111
NlaIV GGNNCC 1 cut(s) 36
NmuCI GTSAC 1 cut(s) 181
PleI GAGTC 2 cut(s) 310, 355
PpsI GAGTC 2 cut(s) 310, 355
Psp1406I AACGTT 1 cut(s) 135
Psp6I CCWGG 1 cut(s) 28
PspGI CCWGG 1 cut(s) 28
PspN4I GGNNCC 1 cut(s) 36
PspPI GGNCC 2 cut(s) 26, 83
RsaI GTAC 2 cut(s) 90, 195
RsaNI GTAC 2 cut(s) 89, 194
RseI CAYNNNNRTG 1 cut(s) 402
SaqAI TTAA 1 cut(s) 459
Sau96I GGNCC 2 cut(s) 26, 83
SchI GAGTC 2 cut(s) 310, 356
ScrFI CCNGG 2 cut(s) 30, 111
SetI ASST 9 cut(s) 103, 138, 235, 289, 339, 367, 412, 416, 474
SfaNI GCATC 1 cut(s) 108
SfcI CTRYAG 1 cut(s) 243
SinI GGWCC 2 cut(s) 26, 83
SmiMI CAYNNNNRTG 1 cut(s) 402
Sse9I AATT 5 cut(s) 200, 327, 358, 434, 456
SsiI CCGC 1 cut(s) 309
SspI AATATT 1 cut(s) 127
SspMI CTAG 1 cut(s) 320
StyD4I CCNGG 2 cut(s) 28, 109
TaaI ACNGT 1 cut(s) 423
TaiI ACGT 2 cut(s) 138, 339
TaqI TCGA 2 cut(s) 154, 217
TasI AATT 5 cut(s) 200, 327, 358, 434, 456
TatI WGTACW 1 cut(s) 193
Tru1I TTAA 1 cut(s) 459
Tru9I TTAA 1 cut(s) 459
TseFI GTSAC 1 cut(s) 181
Tsp45I GTSAC 1 cut(s) 181
TspDTI ATGAA 2 cut(s) 281, 386
VpaK11BI GGWCC 2 cut(s) 26, 83
XapI RAATTY 1 cut(s) 327
XmiI GTMKAC 1 cut(s) 468
XspI CTAG 1 cut(s) 320
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.