MD12G1019800.v1.1

Transcriptional activator

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0020154
Physical Location & Seq
Reverse (-)
1959305 .. 1961762
2458 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1019800.v1.1.491

Sequence Viewer

Length: 204 bp
ATGCGATTAACAGAGTTAAAGCCACTAGGACATACCTGCCAGAAGAAGGAAAAGGAATACAGAGATGCACTTGAGGCTTTCAATGAAAAGAACAGAGAAAATGTGGAGCTTATCACAAAGCTAATGGAGCTGGTGAGCCAAAATGAGAAGACGAGGATGAAGAAGCTGGAGGAGCTGAGCAAGAACATAGAATCTTTAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04115 map04115
Pfam Domains
Protein Families
Transcrip_act

Protein Analysis

68

Amino Acids

8.01

Weight (kDa)

8.76

Isoelectric Point (pI)

24.36

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Transcrip_act PF04949 5 - 65 6.6e-28 Transcriptional activator
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0020154)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G27740
fragaria_vesca FvH4_3g09321
malus_domestica MD12G1019800.v1.1
rosa_samantha Rh3BG202800 Rh3CG193100 Rh3CG200300

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 44
AfiI CCNNNNNNNGG 1 cut(s) 46
AgsI TTSAA 1 cut(s) 82
AluBI AGCT 5 cut(s) 109, 121, 130, 166, 175
AluI AGCT 5 cut(s) 109, 121, 130, 166, 175
AsuHPI GGTGA 1 cut(s) 145
BbsI GAAGAC 1 cut(s) 155
BfaI CTAG 1 cut(s) 26
BfuAI ACCTGC 1 cut(s) 44
BlpI GCTNAGC 1 cut(s) 176
BmsI GCATC 1 cut(s) 55
BpiI GAAGAC 1 cut(s) 155
BpmI CTGGAG 1 cut(s) 188
Bpu1102I GCTNAGC 1 cut(s) 176
BpuEI CTTGAG 1 cut(s) 92
Bsc4I CCNNNNNNNGG 1 cut(s) 46
BseGI GGATG 1 cut(s) 162
BseLI CCNNNNNNNGG 1 cut(s) 46
BseMII CTCAG 1 cut(s) 167
BseRI GAGGAG 1 cut(s) 185
BslI CCNNNNNNNGG 1 cut(s) 46
Bsp1720I GCTNAGC 1 cut(s) 176
BspCNI CTCAG 1 cut(s) 168
BspMI ACCTGC 1 cut(s) 44
BstDEI CTNAG 1 cut(s) 176
BstF5I GGATG 1 cut(s) 162
BstMWI GCNNNNNNNGC 3 cut(s) 74, 127, 172
BstV2I GAAGAC 1 cut(s) 155
BtsCI GGATG 1 cut(s) 162
BveI ACCTGC 1 cut(s) 44
CviJI RGCY 8 cut(s) 22, 77, 109, 121, 130, 138, 166, 175
CviKI_1 RGCY 8 cut(s) 22, 77, 109, 121, 130, 138, 166, 175
DdeI CTNAG 1 cut(s) 176
DraI TTTAAA 1 cut(s) 198
FaiI YATR 2 cut(s) 33, 188
FokI GGATG 1 cut(s) 169
FspBI CTAG 1 cut(s) 26
GsuI CTGGAG 1 cut(s) 188
HinfI GANTC 1 cut(s) 191
HphI GGTGA 1 cut(s) 145
HpyAV CCTTC 1 cut(s) 40
HpyCH4V TGCA 1 cut(s) 68
HpyF10VI GCNNNNNNNGC 3 cut(s) 74, 127, 172
HpyF3I CTNAG 1 cut(s) 176
LmnI GCTCC 3 cut(s) 106, 127, 172
LpnPI CCDG 4 cut(s) 49, 53, 116, 152
LweI GCATC 1 cut(s) 55
MaeI CTAG 1 cut(s) 26
MboII GAAGA 3 cut(s) 55, 160, 172
MnlI CCTC 3 cut(s) 67, 147, 163
MseI TTAA 3 cut(s) 8, 17, 197
MwoI GCNNNNNNNGC 3 cut(s) 74, 127, 172
PfeI GAWTC 1 cut(s) 191
SaqAI TTAA 3 cut(s) 8, 17, 197
SetI ASST 6 cut(s) 38, 111, 123, 132, 168, 177
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 8 cut(s) 38, 48, 52, 83, 143, 165, 179, 193
SmlI CTYRAG 1 cut(s) 71
SmoI CTYRAG 1 cut(s) 71
SspMI CTAG 1 cut(s) 26
TfiI GAWTC 1 cut(s) 191
Tru1I TTAA 3 cut(s) 8, 17, 197
Tru9I TTAA 3 cut(s) 8, 17, 197
TspDTI ATGAA 2 cut(s) 99, 173
XspI CTAG 1 cut(s) 26
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.