MD12G1178400.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
Physical Location & Seq
Forward (+)
25891070 .. 25891593
524 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1178400.v1.1.491

Sequence Viewer

Length: 201 bp
ATGGAGAGGAGGGGAAGGAATAGGAACCATGTCAAGATGGTGGATTGGAAGACCTTGATTTGCTTCAAGCAATCCTTCGTCCTCCCAACTAAGTGGTTCCTTCTCAAGCTTACTTCACATTCAAGGCACAAATCCAAAGGTGAGAAATGGGCATGGATTGGTGAGCTTGTACAAAGACATGGAGTCCTGTGGGGAATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

67

Amino Acids

7.99

Weight (kDa)

11.07

Isoelectric Point (pI)

37.17

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017686)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g10780
malus_domestica MD12G1178400.v1.1
prunus_persica Prupe.6G283600_v2.0.a1
pyrus_communis pycom12g16840
rosa_chinensis RchiOBHm_Chr3g0461821
rosa_laevigata RLG00000024895
rosa_multiflora Rmu_sc0004308.1_g000014
rosa_roxburghii Rroxscaffold_6G00417890
rosa_rugosa Rorug03G0053900
rosa_samantha Rh3AG112000 Rh3BG115300 Rh3DG117000

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 171
AgsI TTSAA 2 cut(s) 67, 123
AhdI GACNNNNNGTC 1 cut(s) 182
AluBI AGCT 2 cut(s) 109, 166
AluI AGCT 2 cut(s) 109, 166
AsuHPI GGTGA 2 cut(s) 152, 173
BbsI GAAGAC 1 cut(s) 56
BccI CCATC 1 cut(s) 31
BmeRI GACNNNNNGTC 1 cut(s) 182
BmiI GGNNCC 2 cut(s) 26, 98
BpiI GAAGAC 1 cut(s) 56
BpuEI CTTGAG 1 cut(s) 89
BseRI GAGGAG 1 cut(s) 22
Bsp1407I TGTACA 1 cut(s) 169
BspLI GGNNCC 2 cut(s) 26, 98
BsrGI TGTACA 1 cut(s) 169
BstAUI TGTACA 1 cut(s) 169
BstDEI CTNAG 1 cut(s) 90
BstV2I GAAGAC 1 cut(s) 56
BstXI CCANNNNNNTGG 1 cut(s) 93
Csp6I GTAC 1 cut(s) 170
CviAII CATG 3 cut(s) 29, 153, 179
CviJI RGCY 2 cut(s) 109, 166
CviKI_1 RGCY 2 cut(s) 109, 166
CviQI GTAC 1 cut(s) 170
DdeI CTNAG 1 cut(s) 90
DriI GACNNNNNGTC 1 cut(s) 182
Eam1105I GACNNNNNGTC 1 cut(s) 182
FaeI CATG 3 cut(s) 32, 156, 182
FaiI YATR 4 cut(s) 30, 154, 180, 199
FalI AAGNNNNNCTT 2 cut(s) 59, 91
FatI CATG 3 cut(s) 28, 152, 178
Hin1II CATG 3 cut(s) 32, 156, 182
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 1 cut(s) 183
HphI GGTGA 2 cut(s) 152, 173
Hpy188III TCNNGA 1 cut(s) 34
HpyAV CCTTC 3 cut(s) 9, 85, 110
HpyF3I CTNAG 1 cut(s) 90
Hsp92II CATG 3 cut(s) 32, 156, 182
MboII GAAGA 1 cut(s) 61
MlyI GAGTC 1 cut(s) 192
MnlI CCTC 2 cut(s) 3, 92
NlaIII CATG 3 cut(s) 32, 156, 182
NlaIV GGNNCC 2 cut(s) 26, 98
PleI GAGTC 1 cut(s) 191
PpsI GAGTC 1 cut(s) 191
PspN4I GGNNCC 2 cut(s) 26, 98
RsaI GTAC 1 cut(s) 171
RsaNI GTAC 1 cut(s) 170
SchI GAGTC 1 cut(s) 192
SetI ASST 4 cut(s) 56, 111, 142, 168
SgeI CNNG 9 cut(s) 41, 46, 67, 79, 118, 135, 165, 179, 191
SmlI CTYRAG 1 cut(s) 104
SmoI CTYRAG 1 cut(s) 104
TatI WGTACW 1 cut(s) 169
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.