MD14G1093400.v1.1

Protein kinase and PP2C-like domain-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
Physical Location & Seq
Reverse (-)
13895908 .. 13896226
319 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1093400.v1.1.491

Sequence Viewer

Length: 222 bp
ATGGTAGTGGAGTTGGAGAGGAAGCAGCGTTGGGGGAGAGAGAAATGCAGCAGCAATTCCATTCCTCTCCTCCATCCTCCACCTTCCTCTTACACTCTCCTCAAACCCATTGTCCGAGGTAAAGTTGCTGTCAAGAAACCCATCCATTCTACTTCTGATGATGTTGATAAATTCCACAAGGAATTGCATTTGCTTCGGTATTATATATATATAGGCATATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

74

Amino Acids

8.51

Weight (kDa)

9.72

Isoelectric Point (pI)

26.34

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 170
ApeKI GCWGC 3 cut(s) 25, 48, 51
ApoI RAATTY 1 cut(s) 170
ArsI GACNNNNNNTTYG 2 cut(s) 96, 128
BbvI GCAGC 3 cut(s) 37, 60, 63
BccI CCATC 2 cut(s) 81, 149
BcgI CGANNNNNNTGC 2 cut(s) 176, 210
BisI GCNGC 3 cut(s) 26, 49, 52
BlsI GCNGC 3 cut(s) 27, 50, 53
BsaJI CCNNGG 1 cut(s) 115
BseDI CCNNGG 1 cut(s) 115
BseGI GGATG 2 cut(s) 73, 141
BseRI GAGGAG 2 cut(s) 59, 89
BseXI GCAGC 3 cut(s) 37, 60, 63
BssECI CCNNGG 1 cut(s) 115
BstF5I GGATG 2 cut(s) 73, 141
BstV1I GCAGC 3 cut(s) 37, 60, 63
BtsCI GGATG 2 cut(s) 73, 141
FaiI YATR 7 cut(s) 204, 206, 208, 210, 212, 218, 220
FauNDI CATATG 1 cut(s) 218
Fnu4HI GCNGC 3 cut(s) 26, 49, 52
FokI GGATG 2 cut(s) 60, 128
Fsp4HI GCNGC 3 cut(s) 26, 49, 52
GluI GCNGC 3 cut(s) 26, 49, 52
Hpy188I TCNGA 2 cut(s) 116, 157
Hpy188III TCNNGA 1 cut(s) 133
HpyAV CCTTC 1 cut(s) 93
HpyCH4V TGCA 2 cut(s) 48, 187
Lsp1109I GCAGC 3 cut(s) 37, 60, 63
MluCI AATT 3 cut(s) 55, 170, 182
MnlI CCTC 7 cut(s) 12, 75, 80, 87, 97, 110, 110
NdeI CATATG 1 cut(s) 218
PkrI GCNGC 3 cut(s) 27, 50, 53
SatI GCNGC 3 cut(s) 26, 49, 52
SetI ASST 2 cut(s) 85, 121
SgeI CNNG 3 cut(s) 128, 145, 190
Sse9I AATT 3 cut(s) 55, 170, 182
TasI AATT 3 cut(s) 55, 170, 182
TseI GCWGC 3 cut(s) 25, 48, 51
XapI RAATTY 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.