MD15G1269700.v1.1

Serine threonine-protein kinase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Reverse (-)
23322542 .. 23323038
497 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1269700.v1.1.491

Sequence Viewer

Length: 411 bp
ATGGCCTTAATGCATTATGTATGCCTTACAACATCTGGCCTATTCCTTTCTTTGAGACAGGTAAGAATCTATAGGGAGAAGGCAGTTCACATATATGCAATGAAGAAGCTTAAGAAATCAGAGATGCTTCGGAGAGGTCAAGTGGAACATGTGAAAGCTAAGAGGAATCTACTTGATCAAGTTGACAATAATTGTATCGACAAGCTCTATTGTTTGTTCCAAGATGAAGAGTACTTGTATCTAATTACGAAATATCTTCCTGGTGGGGATATGATGACTTTAGTGATGCGCAATGATACATTGACAGAAGATGAAGCTAGATTTTATATTGGGGAAACCATCCTAGCTATTGAGTCCATTCATAAACATAATTATATACATAGGTACATTGATGTTAGTTTGATTATCTGA

Protein Analysis

137

Amino Acids

16.13

Weight (kDa)

8.39

Isoelectric Point (pI)

51.59

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Pkinase PF00069 23 - 128 3.7e-15 Protein kinase domain
PK_Tyr_Ser-Thr PF07714 27 - 130 1.6e-06 Protein tyrosine and serine/threonine kinase
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021139)

Species Orthologous Gene IDs
malus_domestica MD15G1269700.v1.1 MD16G1194900.v1.1
pyrus_communis pycom14g05980 pycom17g09670
rosa_multiflora Rmu_co8294415.1_g000001

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 290
AfaI GTAC 2 cut(s) 233, 386
AflII CTTAAG 1 cut(s) 110
AflIII ACRYGT 1 cut(s) 148
AjnI CCWGG 1 cut(s) 259
AluBI AGCT 5 cut(s) 109, 158, 205, 317, 347
AluI AGCT 5 cut(s) 109, 158, 205, 317, 347
Alw26I GTCTC 1 cut(s) 49
AoxI GGCC 2 cut(s) 3, 37
AspLEI GCGC 1 cut(s) 291
BccI CCATC 1 cut(s) 347
BciT130I CCWGG 1 cut(s) 261
BclI TGATCA 1 cut(s) 175
BcoDI GTCTC 1 cut(s) 49
BfaI CTAG 2 cut(s) 318, 344
BfmI CTRYAG 1 cut(s) 70
BfrI CTTAAG 1 cut(s) 110
BmcAI AGTACT 1 cut(s) 233
Bme1390I CCNGG 1 cut(s) 261
BmrFI CCNGG 1 cut(s) 261
BmsI GCATC 2 cut(s) 114, 276
Bse3DI GCAATG 2 cut(s) 105, 298
BseBI CCWGG 1 cut(s) 261
BseGI GGATG 1 cut(s) 339
BseMI GCAATG 2 cut(s) 105, 298
BshFI GGCC 2 cut(s) 5, 39
BsmAI GTCTC 1 cut(s) 49
BsnI GGCC 2 cut(s) 5, 39
Bsp143I GATC 1 cut(s) 175
BspANI GGCC 2 cut(s) 5, 39
BspTI CTTAAG 1 cut(s) 110
BsrDI GCAATG 2 cut(s) 105, 298
BssMI GATC 1 cut(s) 175
Bst2UI CCWGG 1 cut(s) 261
Bst6I CTCTTC 1 cut(s) 222
BstAFI CTTAAG 1 cut(s) 110
BstDEI CTNAG 1 cut(s) 159
BstF5I GGATG 1 cut(s) 339
BstHHI GCGC 1 cut(s) 291
BstKTI GATC 1 cut(s) 178
BstMAI GTCTC 1 cut(s) 49
BstMBI GATC 1 cut(s) 175
BstNI CCWGG 1 cut(s) 261
BstNSI RCATGY 1 cut(s) 152
BstSCI CCNGG 1 cut(s) 259
BstSFI CTRYAG 1 cut(s) 70
BsuRI GGCC 2 cut(s) 5, 39
BtsCI GGATG 1 cut(s) 339
CfoI GCGC 1 cut(s) 291
Csp6I GTAC 2 cut(s) 232, 385
CviAII CATG 1 cut(s) 149
CviJI RGCY 7 cut(s) 5, 39, 109, 158, 205, 317, 347
CviKI_1 RGCY 7 cut(s) 5, 39, 109, 158, 205, 317, 347
CviQI GTAC 2 cut(s) 232, 385
DdeI CTNAG 1 cut(s) 159
DpnI GATC 1 cut(s) 177
DpnII GATC 1 cut(s) 175
Eam1104I CTCTTC 1 cut(s) 222
EarI CTCTTC 1 cut(s) 222
EcoRII CCWGG 1 cut(s) 259
EcoT22I ATGCAT 1 cut(s) 15
FaeI CATG 1 cut(s) 152
FatI CATG 1 cut(s) 148
FbaI TGATCA 1 cut(s) 175
FokI GGATG 1 cut(s) 326
FspBI CTAG 2 cut(s) 318, 344
FspI TGCGCA 1 cut(s) 290
GlaI GCGC 1 cut(s) 290
HaeIII GGCC 2 cut(s) 5, 39
HhaI GCGC 1 cut(s) 291
Hin1II CATG 1 cut(s) 152
Hin6I GCGC 1 cut(s) 289
HinP1I GCGC 1 cut(s) 289
HincII GTYRAC 1 cut(s) 184
HindII GTYRAC 1 cut(s) 184
HindIII AAGCTT 1 cut(s) 107
HinfI GANTC 3 cut(s) 66, 166, 353
Hpy166II GTNNAC 2 cut(s) 88, 184
Hpy188I TCNGA 3 cut(s) 121, 132, 410
Hpy8I GTNNAC 2 cut(s) 88, 184
HpyAV CCTTC 1 cut(s) 73
HpyCH4V TGCA 2 cut(s) 13, 98
HpyF3I CTNAG 1 cut(s) 159
Hsp92II CATG 1 cut(s) 152
HspAI GCGC 1 cut(s) 289
Ksp22I TGATCA 1 cut(s) 175
Kzo9I GATC 1 cut(s) 175
LpnPI CCDG 4 cut(s) 21, 44, 246, 273
LweI GCATC 2 cut(s) 114, 276
MaeI CTAG 2 cut(s) 318, 344
MalI GATC 1 cut(s) 177
MboI GATC 1 cut(s) 175
MboII GAAGA 4 cut(s) 115, 239, 248, 320
MluCI AATT 3 cut(s) 190, 243, 370
MlyI GAGTC 1 cut(s) 362
MnlI CCTC 2 cut(s) 128, 156
Mph1103I ATGCAT 1 cut(s) 15
MseI TTAA 2 cut(s) 8, 111
MslI CAYNNNNRTG 1 cut(s) 93
MspCI CTTAAG 1 cut(s) 110
MspR9I CCNGG 1 cut(s) 261
MvaI CCWGG 1 cut(s) 261
NdeII GATC 1 cut(s) 175
NlaIII CATG 1 cut(s) 152
NsbI TGCGCA 1 cut(s) 290
NsiI ATGCAT 1 cut(s) 15
NspI RCATGY 1 cut(s) 152
PciI ACATGT 1 cut(s) 148
PfeI GAWTC 2 cut(s) 66, 166
PleI GAGTC 1 cut(s) 361
PpsI GAGTC 1 cut(s) 361
PscI ACATGT 1 cut(s) 148
Psp6I CCWGG 1 cut(s) 259
PspGI CCWGG 1 cut(s) 259
RsaI GTAC 2 cut(s) 233, 386
RsaNI GTAC 2 cut(s) 232, 385
RseI CAYNNNNRTG 1 cut(s) 93
SaqAI TTAA 2 cut(s) 8, 111
Sau3AI GATC 1 cut(s) 175
ScaI AGTACT 1 cut(s) 233
SchI GAGTC 1 cut(s) 362
ScrFI CCNGG 1 cut(s) 261
SetI ASST 8 cut(s) 63, 111, 139, 160, 207, 319, 349, 386
SfaNI GCATC 2 cut(s) 114, 276
SfcI CTRYAG 1 cut(s) 70
SmiMI CAYNNNNRTG 1 cut(s) 93
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
Sse9I AATT 3 cut(s) 190, 243, 370
SspMI CTAG 2 cut(s) 318, 344
StyD4I CCNGG 1 cut(s) 259
TaqI TCGA 1 cut(s) 198
TasI AATT 3 cut(s) 190, 243, 370
TatI WGTACW 1 cut(s) 231
TfiI GAWTC 2 cut(s) 66, 166
Tru1I TTAA 2 cut(s) 8, 111
Tru9I TTAA 2 cut(s) 8, 111
TspDTI ATGAA 4 cut(s) 116, 240, 327, 350
Vha464I CTTAAG 1 cut(s) 110
XceI RCATGY 1 cut(s) 152
XspI CTAG 2 cut(s) 318, 344
ZrmI AGTACT 1 cut(s) 233
Zsp2I ATGCAT 1 cut(s) 15
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.