MD15G1279800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
24884431 .. 24884987
557 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1279800.v1.1.491

Sequence Viewer

Length: 189 bp
ATGGAGAGTATTTCAGAAGATAGGAGAAGATCAGATATGGAGCCTCCACCAGCACAAGCCATAGATGCTTCCACAAAGAATTTCGAGATAGAAGAAGATGAGCAGGACAAAGTCATCAATGAGTGCTGTTCCTGCTTTTATGACTGCACGGAGACCTGCTTTGATTACTTATTCTGTAATCTCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.23

Weight (kDa)

4.05

Isoelectric Point (pI)

107.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019193)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15540
malus_domestica MD02G1167600.v1.1 MD15G1279800.v1.1
prunus_persica Prupe.7G137600_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0104841
rosa_roxburghii Rroxscaffold_2G00138730
rosa_samantha Rh2CG178500 Rh7BG136600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 164
AcsI RAATTY 1 cut(s) 79
Alw26I GTCTC 1 cut(s) 146
ApoI RAATTY 1 cut(s) 79
BcoDI GTCTC 1 cut(s) 146
BfuAI ACCTGC 1 cut(s) 164
BmiI GGNNCC 1 cut(s) 42
BmsI GCATC 1 cut(s) 55
BsaI GGTCTC 1 cut(s) 146
BsgI GTGCAG 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 146
Bso31I GGTCTC 1 cut(s) 146
Bsp143I GATC 1 cut(s) 29
BspLI GGNNCC 1 cut(s) 42
BspMI ACCTGC 1 cut(s) 164
BspTNI GGTCTC 1 cut(s) 146
BssMI GATC 1 cut(s) 29
BstKTI GATC 1 cut(s) 32
BstMAI GTCTC 1 cut(s) 146
BstMBI GATC 1 cut(s) 29
BstMWI GCNNNNNNNGC 2 cut(s) 65, 132
BveI ACCTGC 1 cut(s) 164
CviJI RGCY 2 cut(s) 43, 59
CviKI_1 RGCY 2 cut(s) 43, 59
DpnI GATC 1 cut(s) 31
DpnII GATC 1 cut(s) 29
Eco31I GGTCTC 1 cut(s) 146
FaiI YATR 3 cut(s) 38, 62, 141
Hpy188I TCNGA 2 cut(s) 16, 34
Hpy188III TCNNGA 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 147
HpyF10VI GCNNNNNNNGC 2 cut(s) 65, 132
Kzo9I GATC 1 cut(s) 29
LmnI GCTCC 1 cut(s) 40
LpnPI CCDG 4 cut(s) 63, 89, 145, 169
LweI GCATC 1 cut(s) 55
MalI GATC 1 cut(s) 31
MboI GATC 1 cut(s) 29
MboII GAAGA 4 cut(s) 29, 39, 104, 107
MluCI AATT 1 cut(s) 79
MnlI CCTC 1 cut(s) 54
MwoI GCNNNNNNNGC 2 cut(s) 65, 132
NdeII GATC 1 cut(s) 29
NlaIV GGNNCC 1 cut(s) 42
PflFI GACNNNGTC 1 cut(s) 110
PspN4I GGNNCC 1 cut(s) 42
PsyI GACNNNGTC 1 cut(s) 110
Sau3AI GATC 1 cut(s) 29
SetI ASST 1 cut(s) 158
SfaNI GCATC 1 cut(s) 55
SgeI CNNG 7 cut(s) 62, 68, 97, 116, 144, 160, 168
Sse9I AATT 1 cut(s) 79
TaqI TCGA 1 cut(s) 84
TasI AATT 1 cut(s) 79
TspGWI ACGGA 1 cut(s) 164
Tth111I GACNNNGTC 1 cut(s) 110
XapI RAATTY 1 cut(s) 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.