Rh7BG136600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
Physical Location & Seq
Forward (+)
10173605 .. 10174827
1223 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG136600.1

Sequence Viewer

Length: 276 bp
ATGGAACCTCCACCAGCACAAGCCATAGAGACTTCAACCACCTACCAAGAAGATGAACAGAACGAAGTCATCAACGACTTGTATTCGATTATCGATATATTTCTTGTTTATTTTCTTCTTTCTTTGATGATGAACTTGCTGTATCATATTGCTTCGGGTTTCTTTCTTTTAAGTCTTGGGGAACCCAGAATCATGGTGAGAAAAATCTGGCTTCGGGTTTTGGTGATTCAAAAGAGGGAAGAACAGAGGATGGCAGAGGAGGGATTTGAATCTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.71

Weight (kDa)

4.5

Isoelectric Point (pI)

53.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019193)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15540
malus_domestica MD02G1167600.v1.1 MD15G1279800.v1.1
prunus_persica Prupe.7G137600_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0104841
rosa_roxburghii Rroxscaffold_2G00138730
rosa_samantha Rh2CG178500 Rh7BG136600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 3 cut(s) 36, 230, 269
Alw26I GTCTC 1 cut(s) 23
AsuHPI GGTGA 2 cut(s) 208, 235
BccI CCATC 1 cut(s) 244
BcoDI GTCTC 1 cut(s) 23
BmiI GGNNCC 2 cut(s) 6, 183
Bsa29I ATCGAT 1 cut(s) 93
BsaBI GATNNNNATC 1 cut(s) 268
Bse8I GATNNNNATC 1 cut(s) 268
BseCI ATCGAT 1 cut(s) 93
BseGI GGATG 1 cut(s) 255
BseJI GATNNNNATC 1 cut(s) 268
BseRI GAGGAG 1 cut(s) 272
BshVI ATCGAT 1 cut(s) 93
BsmAI GTCTC 1 cut(s) 23
BspDI ATCGAT 1 cut(s) 93
BspLI GGNNCC 2 cut(s) 6, 183
BstF5I GGATG 1 cut(s) 255
BstMAI GTCTC 1 cut(s) 23
BstXI CCANNNNNNTGG 1 cut(s) 193
Bsu15I ATCGAT 1 cut(s) 93
BsuTUI ATCGAT 1 cut(s) 93
BtsCI GGATG 1 cut(s) 255
ClaI ATCGAT 1 cut(s) 93
CviAII CATG 1 cut(s) 193
CviJI RGCY 2 cut(s) 23, 211
CviKI_1 RGCY 2 cut(s) 23, 211
FaeI CATG 1 cut(s) 196
FaiI YATR 4 cut(s) 26, 98, 147, 194
FatI CATG 1 cut(s) 192
FokI GGATG 1 cut(s) 262
Hin1II CATG 1 cut(s) 196
HinfI GANTC 3 cut(s) 189, 226, 269
HphI GGTGA 2 cut(s) 208, 235
Hpy188III TCNNGA 1 cut(s) 273
Hsp92II CATG 1 cut(s) 196
LpnPI CCDG 3 cut(s) 27, 193, 199
MboII GAAGA 3 cut(s) 62, 107, 251
MnlI CCTC 5 cut(s) 18, 228, 240, 250, 253
MseI TTAA 1 cut(s) 170
NlaIII CATG 1 cut(s) 196
NlaIV GGNNCC 2 cut(s) 6, 183
PfeI GAWTC 3 cut(s) 189, 226, 269
PspN4I GGNNCC 2 cut(s) 6, 183
SaqAI TTAA 1 cut(s) 170
SetI ASST 2 cut(s) 10, 44
TaqI TCGA 2 cut(s) 86, 93
TfiI GAWTC 3 cut(s) 189, 226, 269
Tru1I TTAA 1 cut(s) 170
Tru9I TTAA 1 cut(s) 170
TspDTI ATGAA 2 cut(s) 69, 146
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.