Prupe.7G137600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
15424250 .. 15424898
649 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G137600.1

Sequence Viewer

Length: 153 bp
ATGGAACCTCCACCAGCACAAGCCATAGAGACTTCCAGCAACAATTTTCAGGCAGGAGAAGATGAGCAGGACAAAGTCATCAATGAATGTTGTTCCTGCTTTTATGACTGCACAGAGACCTGCTTTGATTACTTATTCTGTAATCTCTGTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.67

Weight (kDa)

4.05

Isoelectric Point (pI)

80.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019193)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g15540
malus_domestica MD02G1167600.v1.1 MD15G1279800.v1.1
prunus_persica Prupe.7G137600_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0104841
rosa_roxburghii Rroxscaffold_2G00138730
rosa_samantha Rh2CG178500 Rh7BG136600

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 128
Alw26I GTCTC 2 cut(s) 23, 110
BcoDI GTCTC 2 cut(s) 23, 110
BfuAI ACCTGC 1 cut(s) 128
BmiI GGNNCC 1 cut(s) 6
BsaI GGTCTC 1 cut(s) 110
BsgI GTGCAG 1 cut(s) 94
BsmAI GTCTC 2 cut(s) 23, 110
Bso31I GGTCTC 1 cut(s) 110
BspLI GGNNCC 1 cut(s) 6
BspMI ACCTGC 1 cut(s) 128
BspTNI GGTCTC 1 cut(s) 110
BstMAI GTCTC 2 cut(s) 23, 110
BveI ACCTGC 1 cut(s) 128
CviJI RGCY 1 cut(s) 23
CviKI_1 RGCY 1 cut(s) 23
Eco31I GGTCTC 1 cut(s) 110
FaiI YATR 2 cut(s) 26, 105
HpyCH4V TGCA 1 cut(s) 111
LpnPI CCDG 7 cut(s) 27, 35, 39, 49, 53, 109, 133
MboII GAAGA 1 cut(s) 71
MluCI AATT 1 cut(s) 43
MnlI CCTC 1 cut(s) 18
NlaIV GGNNCC 1 cut(s) 6
PflFI GACNNNGTC 1 cut(s) 74
PspN4I GGNNCC 1 cut(s) 6
PsyI GACNNNGTC 1 cut(s) 74
SetI ASST 2 cut(s) 10, 122
SgeI CNNG 8 cut(s) 26, 32, 48, 62, 66, 80, 108, 132
Sse9I AATT 1 cut(s) 43
TasI AATT 1 cut(s) 43
TspDTI ATGAA 1 cut(s) 99
Tth111I GACNNNGTC 1 cut(s) 74
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.