MD17G1205100.v1.1

Asp/Glu/Hydantoin racemase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
24848584 .. 24848945
362 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1205100.v1.1.491

Sequence Viewer

Length: 264 bp
ATGATGTTTCATGGTGAAGATGGTTCAAAGAAGAAAAAACAGAAGAAGAAAAAGGATCCAAATGTACCGAGAAGAGCAATGTTTGGTTTCATGTTCTTCTCAAATATGGAGAGAGATAATGTAAAGAGAGAGAACCATGGAATTGCGTTTACTGATGTGGGGAGAGTACTTGGAGAGAAATGGAAAAAGATGTCTGGTATGTGTGATTCTACTAAATTACATCTTGTGTGCTTCCACAACATGACGAATTTCTGCGAATTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

88

Amino Acids

10.22

Weight (kDa)

9.72

Isoelectric Point (pI)

30.95

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
HMG_box_2 PF09011 20 - 66 4.2e-06 HMG-box domain
HMG_box PF00505 23 - 65 4.1e-08 HMG (high mobility group) box
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021198)

Species Orthologous Gene IDs
malus_domestica MD17G1205100.v1.1
pyrus_communis pycom111g03830 pycom17g20890
rosa_multiflora Rmu_sc0040367.1_g000001 Rmu_ssc0000393.1_g000031

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 262
AclWI GGATC 2 cut(s) 50, 63
AcsI RAATTY 1 cut(s) 247
AfaI GTAC 2 cut(s) 66, 168
AgsI TTSAA 1 cut(s) 27
AlwI GGATC 2 cut(s) 50, 63
ApoI RAATTY 1 cut(s) 247
AsuHPI GGTGA 1 cut(s) 26
BamHI GGATCC 1 cut(s) 55
BccI CCATC 1 cut(s) 14
BmcAI AGTACT 1 cut(s) 168
BmiI GGNNCC 1 cut(s) 57
BsaJI CCNNGG 1 cut(s) 136
Bse3DI GCAATG 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 136
BseMI GCAATG 1 cut(s) 84
Bsp143I GATC 1 cut(s) 55
Bsp19I CCATGG 1 cut(s) 136
BspLI GGNNCC 1 cut(s) 57
BspPI GGATC 2 cut(s) 50, 63
BspQI GCTCTTC 1 cut(s) 67
BsrDI GCAATG 1 cut(s) 84
BssECI CCNNGG 1 cut(s) 136
BssMI GATC 1 cut(s) 55
BssT1I CCWWGG 1 cut(s) 136
Bst6I CTCTTC 1 cut(s) 67
BstDSI CCRYGG 1 cut(s) 136
BstKTI GATC 1 cut(s) 58
BstMBI GATC 1 cut(s) 55
BstX2I RGATCY 1 cut(s) 55
BstYI RGATCY 1 cut(s) 55
BtgI CCRYGG 1 cut(s) 136
Csp6I GTAC 2 cut(s) 65, 167
CviAII CATG 4 cut(s) 11, 91, 137, 241
CviQI GTAC 2 cut(s) 65, 167
DpnI GATC 1 cut(s) 57
DpnII GATC 1 cut(s) 55
Eam1104I CTCTTC 1 cut(s) 67
EarI CTCTTC 1 cut(s) 67
Eco130I CCWWGG 1 cut(s) 136
EcoT14I CCWWGG 1 cut(s) 136
ErhI CCWWGG 1 cut(s) 136
FaeI CATG 4 cut(s) 14, 94, 140, 244
FaiI YATR 7 cut(s) 12, 92, 107, 138, 200, 242, 262
FatI CATG 4 cut(s) 10, 90, 136, 240
Hin1II CATG 4 cut(s) 14, 94, 140, 244
HinfI GANTC 1 cut(s) 206
HphI GGTGA 1 cut(s) 26
Hpy166II GTNNAC 1 cut(s) 150
Hpy8I GTNNAC 1 cut(s) 150
Hsp92II CATG 4 cut(s) 14, 94, 140, 244
Kzo9I GATC 1 cut(s) 55
LguI GCTCTTC 1 cut(s) 67
LpnPI CCDG 1 cut(s) 180
MalI GATC 1 cut(s) 57
MboI GATC 1 cut(s) 55
MboII GAAGA 6 cut(s) 29, 43, 55, 58, 84, 88
MflI RGATCY 1 cut(s) 55
MluCI AATT 4 cut(s) 141, 215, 247, 257
NcoI CCATGG 1 cut(s) 136
NdeII GATC 1 cut(s) 55
NlaIII CATG 4 cut(s) 14, 94, 140, 244
NlaIV GGNNCC 1 cut(s) 57
PciSI GCTCTTC 1 cut(s) 67
PfeI GAWTC 1 cut(s) 206
PsiI TTATAA 1 cut(s) 262
PspN4I GGNNCC 1 cut(s) 57
PsuI RGATCY 1 cut(s) 55
RsaI GTAC 2 cut(s) 66, 168
RsaNI GTAC 2 cut(s) 65, 167
SapI GCTCTTC 1 cut(s) 67
Sau3AI GATC 1 cut(s) 55
ScaI AGTACT 1 cut(s) 168
SgeI CNNG 8 cut(s) 23, 81, 103, 149, 182, 207, 236, 253
Sse9I AATT 4 cut(s) 141, 215, 247, 257
StyI CCWWGG 1 cut(s) 136
TasI AATT 4 cut(s) 141, 215, 247, 257
TatI WGTACW 1 cut(s) 166
TfiI GAWTC 1 cut(s) 206
TspDTI ATGAA 1 cut(s) 79
XapI RAATTY 1 cut(s) 247
ZrmI AGTACT 1 cut(s) 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.