Rmu_sc0040367.1_g000001

Asp/Glu/Hydantoin racemase

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0040367.1
Physical Location & Seq
Reverse (-)
1 .. 1877
1877 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0040367.1_g000001.1.cds

Sequence Viewer

Length: 241 bp
atggaacacactgtcatccctgctattgaagcttttaatagaaaagacatagaggggtcacaaaatcttttgaggattgcactccaggttcttctggtgagggctgtgaactctgtgattcttgcctttgatgatatgcatgatctccttccccgagatgatcctcttattaagaaatgcattgaccctatggatgcattggcctggtcaaccataaaatgggctacatctgctgaaaaag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

80

Amino Acids

9.03

Weight (kDa)

5.15

Isoelectric Point (pI)

36.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0021198)

Species Orthologous Gene IDs
malus_domestica MD17G1205100.v1.1
pyrus_communis pycom111g03830 pycom17g20890
rosa_multiflora Rmu_sc0040367.1_g000001 Rmu_ssc0000393.1_g000031

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 219
AclWI GGATC 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 219
AgsI TTSAA 1 cut(s) 29
AjnI CCWGG 2 cut(s) 84, 203
AluBI AGCT 1 cut(s) 32
AluI AGCT 1 cut(s) 32
AlwI GGATC 1 cut(s) 155
Ama87I CYCGRG 1 cut(s) 153
AoxI GGCC 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 109
AvaI CYCGRG 1 cut(s) 153
BciT130I CCWGG 2 cut(s) 86, 205
Bme1390I CCNGG 2 cut(s) 86, 205
BmeT110I CYCGRG 1 cut(s) 153
BmrFI CCNGG 2 cut(s) 86, 205
BmsI GCATC 1 cut(s) 184
BpmI CTGGAG 1 cut(s) 68
Bsc4I CCNNNNNNNGG 1 cut(s) 219
BseBI CCWGG 2 cut(s) 86, 205
BseGI GGATG 2 cut(s) 15, 199
BseLI CCNNNNNNNGG 1 cut(s) 219
BshFI GGCC 1 cut(s) 203
BsiHKCI CYCGRG 1 cut(s) 153
BslI CCNNNNNNNGG 1 cut(s) 219
BsnI GGCC 1 cut(s) 203
BsoBI CYCGRG 1 cut(s) 153
Bsp143I GATC 2 cut(s) 142, 160
BspANI GGCC 1 cut(s) 203
BspPI GGATC 1 cut(s) 155
BssMI GATC 2 cut(s) 142, 160
Bst2UI CCWGG 2 cut(s) 86, 205
Bst4CI ACNGT 1 cut(s) 13
BstF5I GGATG 2 cut(s) 15, 199
BstKTI GATC 2 cut(s) 145, 163
BstMBI GATC 2 cut(s) 142, 160
BstMWI GCNNNNNNNGC 2 cut(s) 29, 230
BstNI CCWGG 2 cut(s) 86, 205
BstSCI CCNGG 2 cut(s) 84, 203
BsuRI GGCC 1 cut(s) 203
BtsCI GGATG 2 cut(s) 15, 199
BtsIMutI CAGTG 1 cut(s) 9
CviAII CATG 1 cut(s) 140
CviJI RGCY 4 cut(s) 32, 104, 203, 224
CviKI_1 RGCY 4 cut(s) 32, 104, 203, 224
DpnI GATC 2 cut(s) 144, 162
DpnII GATC 2 cut(s) 142, 160
Eco88I CYCGRG 1 cut(s) 153
EcoRII CCWGG 2 cut(s) 84, 203
EcoT22I ATGCAT 3 cut(s) 141, 182, 199
FaeI CATG 1 cut(s) 143
FaiI YATR 5 cut(s) 50, 137, 141, 191, 215
FatI CATG 1 cut(s) 139
FokI GGATG 2 cut(s) 2, 206
GsuI CTGGAG 1 cut(s) 68
HaeIII GGCC 1 cut(s) 203
Hin1II CATG 1 cut(s) 143
HincII GTYRAC 1 cut(s) 210
HindII GTYRAC 1 cut(s) 210
HindIII AAGCTT 1 cut(s) 30
HinfI GANTC 1 cut(s) 118
HphI GGTGA 1 cut(s) 109
Hpy166II GTNNAC 2 cut(s) 109, 210
Hpy8I GTNNAC 2 cut(s) 109, 210
HpyAV CCTTC 1 cut(s) 158
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4V TGCA 4 cut(s) 80, 139, 180, 197
HpyF10VI GCNNNNNNNGC 2 cut(s) 29, 230
Hsp92II CATG 1 cut(s) 143
Kzo9I GATC 2 cut(s) 142, 160
LpnPI CCDG 6 cut(s) 33, 71, 80, 98, 190, 217
LweI GCATC 1 cut(s) 184
MaeIII GTNAC 1 cut(s) 57
MalI GATC 2 cut(s) 144, 162
MboI GATC 2 cut(s) 142, 160
MboII GAAGA 1 cut(s) 83
MnlI CCTC 4 cut(s) 46, 66, 93, 174
Mph1103I ATGCAT 3 cut(s) 141, 182, 199
MseI TTAA 2 cut(s) 36, 171
MspR9I CCNGG 2 cut(s) 86, 205
MvaI CCWGG 2 cut(s) 86, 205
MwoI GCNNNNNNNGC 2 cut(s) 29, 230
NdeII GATC 2 cut(s) 142, 160
NlaIII CATG 1 cut(s) 143
NmuCI GTSAC 1 cut(s) 57
NsiI ATGCAT 3 cut(s) 141, 182, 199
PfeI GAWTC 1 cut(s) 118
PflMI CCANNNNNTGG 1 cut(s) 219
Psp6I CCWGG 2 cut(s) 84, 203
PspGI CCWGG 2 cut(s) 84, 203
SaqAI TTAA 2 cut(s) 36, 171
Sau3AI GATC 2 cut(s) 142, 160
ScrFI CCNGG 2 cut(s) 86, 205
SetI ASST 2 cut(s) 34, 90
SfaNI GCATC 1 cut(s) 184
StyD4I CCNGG 2 cut(s) 84, 203
TaaI ACNGT 1 cut(s) 13
TfiI GAWTC 1 cut(s) 118
Tru1I TTAA 2 cut(s) 36, 171
Tru9I TTAA 2 cut(s) 36, 171
TscAI CASTG 1 cut(s) 16
TseFI GTSAC 1 cut(s) 57
Tsp45I GTSAC 1 cut(s) 57
TspRI CASTG 1 cut(s) 16
Van91I CCANNNNNTGG 1 cut(s) 219
Zsp2I ATGCAT 3 cut(s) 141, 182, 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.