Prupe.1G114900_v2.0.a1

ATP-dependent Clp protease adaptor protein ClpS

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0021217
Physical Location & Seq
Reverse (-)
9094140 .. 9094522
383 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G114900.1_v2.0.a1.CDS.2

Sequence Viewer

Length: 204 bp
ATGGCTGTGAAGGCCAGGTTTAGGTCTTCCAAGGGTGGTGCTGGGGTCTTGGAGCGCCCAAAGTTTGACCAATCCCAATTTGACCCTGCTACCCAGCTTGAACAAGGAGGAGATATTGGACGACTCAAGGACAAGAGAGGTATTGGGAGTAGGGATAGTTACAGAGTTTTGCTGGTTGATGATGTTCGCCACACTGAGAAATTA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ClpS

Protein Analysis

68

Amino Acids

7.59

Weight (kDa)

9.86

Isoelectric Point (pI)

44.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 1 cut(s) 21
AgsI TTSAA 1 cut(s) 101
AjnI CCWGG 1 cut(s) 14
AluBI AGCT 1 cut(s) 97
AluI AGCT 1 cut(s) 97
AoxI GGCC 1 cut(s) 12
AspLEI GCGC 1 cut(s) 57
BbsI GAAGAC 1 cut(s) 18
BciT130I CCWGG 1 cut(s) 16
BfoI RGCGCY 1 cut(s) 58
Bme1390I CCNGG 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 18
BpuEI CTTGAG 1 cut(s) 110
BsaJI CCNNGG 1 cut(s) 30
Bsc4I CCNNNNNNNGG 1 cut(s) 21
BseBI CCWGG 1 cut(s) 16
BseDI CCNNGG 1 cut(s) 30
BseLI CCNNNNNNNGG 1 cut(s) 21
BseMII CTCAG 1 cut(s) 186
BseRI GAGGAG 1 cut(s) 123
BseYI CCCAGC 2 cut(s) 41, 93
BshFI GGCC 1 cut(s) 14
BslI CCNNNNNNNGG 1 cut(s) 21
BsnI GGCC 1 cut(s) 14
BspANI GGCC 1 cut(s) 14
BspCNI CTCAG 1 cut(s) 187
BssECI CCNNGG 1 cut(s) 30
BssT1I CCWWGG 1 cut(s) 30
Bst2UI CCWGG 1 cut(s) 16
BstDEI CTNAG 1 cut(s) 195
BstH2I RGCGCY 1 cut(s) 58
BstHHI GCGC 1 cut(s) 57
BstMWI GCNNNNNNNGC 1 cut(s) 11
BstNI CCWGG 1 cut(s) 16
BstSCI CCNGG 1 cut(s) 14
BstV2I GAAGAC 1 cut(s) 18
BsuRI GGCC 1 cut(s) 14
BtsIMutI CAGTG 1 cut(s) 192
CfoI GCGC 1 cut(s) 57
CviJI RGCY 3 cut(s) 5, 14, 97
CviKI_1 RGCY 3 cut(s) 5, 14, 97
DdeI CTNAG 1 cut(s) 195
Eco130I CCWWGG 1 cut(s) 30
EcoRII CCWGG 1 cut(s) 14
EcoT14I CCWWGG 1 cut(s) 30
ErhI CCWWGG 1 cut(s) 30
GlaI GCGC 1 cut(s) 56
GsaI CCCAGC 2 cut(s) 45, 97
HaeII RGCGCY 1 cut(s) 58
HaeIII GGCC 1 cut(s) 14
HhaI GCGC 1 cut(s) 57
Hin6I GCGC 1 cut(s) 55
HinP1I GCGC 1 cut(s) 55
HinfI GANTC 1 cut(s) 123
HpyAV CCTTC 1 cut(s) 4
HpyF10VI GCNNNNNNNGC 1 cut(s) 11
HpyF3I CTNAG 1 cut(s) 195
HspAI GCGC 1 cut(s) 55
LmnI GCTCC 1 cut(s) 52
LpnPI CCDG 5 cut(s) 27, 28, 99, 107, 158
MaeIII GTNAC 1 cut(s) 158
MboII GAAGA 1 cut(s) 18
MluCI AATT 2 cut(s) 77, 200
MlyI GAGTC 1 cut(s) 117
MnlI CCTC 2 cut(s) 101, 131
MspR9I CCNGG 1 cut(s) 16
MvaI CCWGG 1 cut(s) 16
MwoI GCNNNNNNNGC 1 cut(s) 11
PleI GAGTC 1 cut(s) 117
PpsI GAGTC 1 cut(s) 117
Psp6I CCWGG 1 cut(s) 14
PspFI CCCAGC 2 cut(s) 41, 93
PspGI CCWGG 1 cut(s) 14
SchI GAGTC 1 cut(s) 117
ScrFI CCNGG 1 cut(s) 16
SetI ASST 4 cut(s) 20, 26, 99, 142
SmlI CTYRAG 1 cut(s) 125
SmoI CTYRAG 1 cut(s) 125
Sse9I AATT 2 cut(s) 77, 200
StyD4I CCNGG 1 cut(s) 14
StyI CCWWGG 1 cut(s) 30
TasI AATT 2 cut(s) 77, 200
TscAI CASTG 1 cut(s) 199
TspRI CASTG 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.