Prupe.1G384300_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Reverse (-)
34482456 .. 34482731
276 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G384300.1

Sequence Viewer

Length: 276 bp
ATGGGTCCTCCCCTTAAAGAAATTAATTTAATATCGTGTGGGCCTATGGCCCACGTATCAGATATTAAACTGATAAGAACAGATACTACACTTGATCTTAGCCAAAAGGCCGAGAAAGGTATGCTTTGTTCAGCAACACGTTTTCGTTTTTATATGGCATGCAAGCTTCCCTGTTTTATGATGCTGGCGATATGGGACGAAAAAACGCAAGATATGATGCATTCTCTTTTCCCTACGACCAATATTCTCTTTTCCATCAATTTCACAAGTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

92

Amino Acids

10.35

Weight (kDa)

7.68

Isoelectric Point (pI)

41.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AflIII ACRYGT 1 cut(s) 137
AluBI AGCT 1 cut(s) 166
AluI AGCT 1 cut(s) 166
AoxI GGCC 3 cut(s) 41, 48, 108
AseI ATTAAT 1 cut(s) 24
AspS9I GGNCC 3 cut(s) 5, 41, 49
AvaII GGWCC 1 cut(s) 5
BccI CCATC 1 cut(s) 263
Bme18I GGWCC 1 cut(s) 5
BmgT120I GGNCC 3 cut(s) 5, 41, 49
BmiI GGNNCC 1 cut(s) 6
BmsI GCATC 2 cut(s) 171, 207
BsaAI YACGTR 1 cut(s) 55
BshFI GGCC 3 cut(s) 43, 50, 110
BslFI GGGAC 1 cut(s) 209
BsmFI GGGAC 1 cut(s) 209
BsmI GAATGC 1 cut(s) 220
BsnI GGCC 3 cut(s) 43, 50, 110
Bsp143I GATC 1 cut(s) 94
BspANI GGCC 3 cut(s) 43, 50, 110
BspLI GGNNCC 1 cut(s) 6
BssMI GATC 1 cut(s) 94
BstBAI YACGTR 1 cut(s) 55
BstC8I GCNNGC 3 cut(s) 160, 164, 186
BstDEI CTNAG 1 cut(s) 98
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BstNSI RCATGY 1 cut(s) 162
BsuRI GGCC 3 cut(s) 43, 50, 110
Cac8I GCNNGC 3 cut(s) 160, 164, 186
Cfr13I GGNCC 3 cut(s) 5, 41, 49
CviAII CATG 1 cut(s) 159
CviJI RGCY 5 cut(s) 43, 50, 102, 110, 166
CviKI_1 RGCY 5 cut(s) 43, 50, 102, 110, 166
DdeI CTNAG 1 cut(s) 98
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco47I GGWCC 1 cut(s) 5
EcoO109I RGGNCCY 1 cut(s) 5
EcoT22I ATGCAT 1 cut(s) 222
FaeI CATG 1 cut(s) 162
FaiI YATR 9 cut(s) 47, 122, 153, 155, 160, 179, 193, 215, 274
FalI AAGNNNNNCTT 2 cut(s) 108, 140
FaqI GGGAC 1 cut(s) 209
FatI CATG 1 cut(s) 158
HaeIII GGCC 3 cut(s) 43, 50, 110
Hin1II CATG 1 cut(s) 162
HindIII AAGCTT 1 cut(s) 164
Hpy188I TCNGA 1 cut(s) 61
HpyCH4IV ACGT 2 cut(s) 54, 139
HpyCH4V TGCA 2 cut(s) 162, 220
HpyF3I CTNAG 1 cut(s) 98
HpySE526I ACGT 2 cut(s) 54, 139
Hsp92II CATG 1 cut(s) 162
Kzo9I GATC 1 cut(s) 94
LpnPI CCDG 2 cut(s) 170, 184
LweI GCATC 2 cut(s) 171, 207
MaeII ACGT 2 cut(s) 54, 139
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MluCI AATT 3 cut(s) 21, 25, 259
MnlI CCTC 1 cut(s) 18
Mph1103I ATGCAT 1 cut(s) 222
MseI TTAA 4 cut(s) 15, 24, 29, 66
Mva1269I GAATGC 1 cut(s) 220
NdeII GATC 1 cut(s) 94
NlaIII CATG 1 cut(s) 162
NlaIV GGNNCC 1 cut(s) 6
NmeAIII GCCGAG 1 cut(s) 136
NsiI ATGCAT 1 cut(s) 222
NspI RCATGY 1 cut(s) 162
PaeI GCATGC 1 cut(s) 162
PctI GAATGC 1 cut(s) 220
Ppu21I YACGTR 1 cut(s) 55
PpuMI RGGWCCY 1 cut(s) 5
PshBI ATTAAT 1 cut(s) 24
Psp5II RGGWCCY 1 cut(s) 5
PspN4I GGNNCC 1 cut(s) 6
PspPI GGNCC 3 cut(s) 5, 41, 49
PspPPI RGGWCCY 1 cut(s) 5
PsrI GAACNNNNNNTAC 4 cut(s) 70, 102, 112, 144
SaqAI TTAA 4 cut(s) 15, 24, 29, 66
Sau3AI GATC 1 cut(s) 94
Sau96I GGNCC 3 cut(s) 5, 41, 49
SetI ASST 4 cut(s) 57, 121, 142, 168
SfaNI GCATC 2 cut(s) 171, 207
SinI GGWCC 1 cut(s) 5
SphI GCATGC 1 cut(s) 162
Sse9I AATT 3 cut(s) 21, 25, 259
SspI AATATT 1 cut(s) 244
TaiI ACGT 2 cut(s) 57, 142
TasI AATT 3 cut(s) 21, 25, 259
Tru1I TTAA 4 cut(s) 15, 24, 29, 66
Tru9I TTAA 4 cut(s) 15, 24, 29, 66
VpaK11BI GGWCC 1 cut(s) 5
VspI ATTAAT 1 cut(s) 24
XceI RCATGY 1 cut(s) 162
Zsp2I ATGCAT 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.