Prupe.8G172100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Forward (+)
17585109 .. 17586022
914 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G172100.1

Sequence Viewer

Length: 252 bp
ATGCAAGCTACTGTGGAGGACACTCCCCCAAAAGAAATTAATTTAATATCGTGTGGACCATTGGTCCACGTATCAGATATTAAACTGATAAGAACAGATACTACACTTGATCTTAGCCAAAAGGCCGAGAAAGGTATGCTTCTTTTCTTCTCTTCTTTCTCCTTTTATAGGGCCATTCACTTCCATGCTTCCTTGGTGAAGCCGATGTGGGATTGTTACAAACAGCTAGAGGGTGCCACGAACGAAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.36

Weight (kDa)

5.82

Isoelectric Point (pI)

17.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 233
AfiI CCNNNNNNNGG 1 cut(s) 168
AhdI GACNNNNNGTC 1 cut(s) 62
AluBI AGCT 2 cut(s) 8, 226
AluI AGCT 2 cut(s) 8, 226
AoxI GGCC 2 cut(s) 123, 171
AseI ATTAAT 1 cut(s) 39
AspS9I GGNCC 3 cut(s) 56, 64, 171
AsuHPI GGTGA 1 cut(s) 208
AvaII GGWCC 2 cut(s) 56, 64
BanI GGYRCC 1 cut(s) 233
BfaI CTAG 1 cut(s) 227
Bme18I GGWCC 2 cut(s) 56, 64
BmeRI GACNNNNNGTC 1 cut(s) 62
BmgT120I GGNCC 3 cut(s) 56, 64, 171
BmiI GGNNCC 1 cut(s) 235
BsaAI YACGTR 1 cut(s) 70
BsaJI CCNNGG 1 cut(s) 192
Bsc4I CCNNNNNNNGG 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 192
BseLI CCNNNNNNNGG 1 cut(s) 168
BshFI GGCC 2 cut(s) 125, 173
BshNI GGYRCC 1 cut(s) 233
BslI CCNNNNNNNGG 1 cut(s) 168
BsnI GGCC 2 cut(s) 125, 173
Bsp143I GATC 1 cut(s) 109
BspANI GGCC 2 cut(s) 125, 173
BspLI GGNNCC 1 cut(s) 235
BspT107I GGYRCC 1 cut(s) 233
BssECI CCNNGG 1 cut(s) 192
BssMI GATC 1 cut(s) 109
BssT1I CCWWGG 1 cut(s) 192
Bst4CI ACNGT 1 cut(s) 13
Bst6I CTCTTC 1 cut(s) 157
BstBAI YACGTR 1 cut(s) 70
BstC8I GCNNGC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 113
BstENI CCTNNNNNAGG 1 cut(s) 166
BstKTI GATC 1 cut(s) 112
BstMBI GATC 1 cut(s) 109
BsuRI GGCC 2 cut(s) 125, 173
Cac8I GCNNGC 1 cut(s) 6
Cfr13I GGNCC 3 cut(s) 56, 64, 171
CviAII CATG 1 cut(s) 185
CviJI RGCY 7 cut(s) 8, 117, 125, 173, 202, 226, 249
CviKI_1 RGCY 7 cut(s) 8, 117, 125, 173, 202, 226, 249
DdeI CTNAG 1 cut(s) 113
DpnI GATC 1 cut(s) 111
DpnII GATC 1 cut(s) 109
DriI GACNNNNNGTC 1 cut(s) 62
Eam1104I CTCTTC 1 cut(s) 157
Eam1105I GACNNNNNGTC 1 cut(s) 62
EarI CTCTTC 1 cut(s) 157
Eco130I CCWWGG 1 cut(s) 192
Eco47I GGWCC 2 cut(s) 56, 64
EcoNI CCTNNNNNAGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 192
ErhI CCWWGG 1 cut(s) 192
FaeI CATG 1 cut(s) 188
FaiI YATR 3 cut(s) 137, 168, 186
FalI AAGNNNNNCTT 2 cut(s) 123, 155
FatI CATG 1 cut(s) 184
FspBI CTAG 1 cut(s) 227
HaeIII GGCC 2 cut(s) 125, 173
Hin1II CATG 1 cut(s) 188
HphI GGTGA 1 cut(s) 208
Hpy166II GTNNAC 2 cut(s) 56, 67
Hpy188I TCNGA 1 cut(s) 76
Hpy8I GTNNAC 2 cut(s) 56, 67
HpyAV CCTTC 1 cut(s) 239
HpyCH4III ACNGT 1 cut(s) 13
HpyCH4IV ACGT 1 cut(s) 69
HpyCH4V TGCA 1 cut(s) 4
HpyF3I CTNAG 1 cut(s) 113
HpySE526I ACGT 1 cut(s) 69
Hsp92II CATG 1 cut(s) 188
Kzo9I GATC 1 cut(s) 109
MaeI CTAG 1 cut(s) 227
MaeII ACGT 1 cut(s) 69
MaeIII GTNAC 1 cut(s) 215
MalI GATC 1 cut(s) 111
MboI GATC 1 cut(s) 109
MboII GAAGA 2 cut(s) 139, 144
MluCI AATT 2 cut(s) 36, 40
MnlI CCTC 2 cut(s) 10, 223
MseI TTAA 3 cut(s) 39, 44, 81
MslI CAYNNNNRTG 1 cut(s) 183
NdeII GATC 1 cut(s) 109
NlaIII CATG 1 cut(s) 188
NlaIV GGNNCC 1 cut(s) 235
NmeAIII GCCGAG 1 cut(s) 151
Ppu21I YACGTR 1 cut(s) 70
PshBI ATTAAT 1 cut(s) 39
PspN4I GGNNCC 1 cut(s) 235
PspPI GGNCC 3 cut(s) 56, 64, 171
PsrI GAACNNNNNNTAC 2 cut(s) 85, 117
RseI CAYNNNNRTG 1 cut(s) 183
SaqAI TTAA 3 cut(s) 39, 44, 81
Sau3AI GATC 1 cut(s) 109
Sau96I GGNCC 3 cut(s) 56, 64, 171
SetI ASST 4 cut(s) 10, 72, 136, 228
SgeI CNNG 8 cut(s) 17, 63, 80, 119, 139, 197, 205, 239
SinI GGWCC 2 cut(s) 56, 64
SmiMI CAYNNNNRTG 1 cut(s) 183
Sse9I AATT 2 cut(s) 36, 40
SspMI CTAG 1 cut(s) 227
StyI CCWWGG 1 cut(s) 192
TaaI ACNGT 1 cut(s) 13
TaiI ACGT 1 cut(s) 72
TasI AATT 2 cut(s) 36, 40
Tru1I TTAA 3 cut(s) 39, 44, 81
Tru9I TTAA 3 cut(s) 39, 44, 81
VpaK11BI GGWCC 2 cut(s) 56, 64
VspI ATTAAT 1 cut(s) 39
XagI CCTNNNNNAGG 1 cut(s) 166
XspI CTAG 1 cut(s) 227
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.