Prupe.8G171300_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
OG0017548
Physical Location & Seq
Forward (+)
17539998 .. 17541071
1074 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G171300.1

Sequence Viewer

Length: 270 bp
ATGGCTTCCTGGAATTCACATCAAGCTACTGTGGCGGACCCTCCCCCAAAAGAAATTAATTTAATATCGTGTGGACCATTGGTCCACGTATCAGATATTAAACTAATAAGAACAGATACTACACTGGATCTTAGCCAAAAGGCCGAGAAAGGTATGCTTCTTCTCTTCTCTTCTTTCTTCTTTTATAGGGCCATTCACTTCCATGCTTCCTTGGTGAAGCCGATGTGGGATTGTTACAAACAGCTAGAGGGTGCCACGAACGAAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

10.01

Weight (kDa)

6.38

Isoelectric Point (pI)

21.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 251
AciI CCGC 1 cut(s) 35
AclWI GGATC 1 cut(s) 135
AcsI RAATTY 1 cut(s) 13
AhdI GACNNNNNGTC 1 cut(s) 80
AjnI CCWGG 1 cut(s) 8
AluBI AGCT 2 cut(s) 26, 244
AluI AGCT 2 cut(s) 26, 244
AlwI GGATC 1 cut(s) 135
AoxI GGCC 2 cut(s) 141, 189
ApoI RAATTY 1 cut(s) 13
AseI ATTAAT 1 cut(s) 57
AspS9I GGNCC 4 cut(s) 37, 74, 82, 189
AsuHPI GGTGA 1 cut(s) 226
AvaII GGWCC 3 cut(s) 37, 74, 82
BanI GGYRCC 1 cut(s) 251
BciT130I CCWGG 1 cut(s) 10
BfaI CTAG 1 cut(s) 245
Bme1390I CCNGG 1 cut(s) 10
Bme18I GGWCC 3 cut(s) 37, 74, 82
BmeRI GACNNNNNGTC 1 cut(s) 80
BmgT120I GGNCC 4 cut(s) 37, 74, 82, 189
BmiI GGNNCC 2 cut(s) 39, 253
BmrFI CCNGG 1 cut(s) 10
BsaAI YACGTR 1 cut(s) 88
BsaJI CCNNGG 1 cut(s) 210
Bse1I ACTGG 1 cut(s) 129
BseBI CCWGG 1 cut(s) 10
BseDI CCNNGG 1 cut(s) 210
BseNI ACTGG 1 cut(s) 129
BshFI GGCC 2 cut(s) 143, 191
BshNI GGYRCC 1 cut(s) 251
BsnI GGCC 2 cut(s) 143, 191
Bsp143I GATC 1 cut(s) 127
BspACI CCGC 1 cut(s) 35
BspANI GGCC 2 cut(s) 143, 191
BspLI GGNNCC 2 cut(s) 39, 253
BspPI GGATC 1 cut(s) 135
BspT107I GGYRCC 1 cut(s) 251
BsrI ACTGG 1 cut(s) 129
BssECI CCNNGG 1 cut(s) 210
BssMI GATC 1 cut(s) 127
BssT1I CCWWGG 1 cut(s) 210
Bst2UI CCWGG 1 cut(s) 10
Bst4CI ACNGT 1 cut(s) 31
Bst6I CTCTTC 2 cut(s) 170, 175
BstBAI YACGTR 1 cut(s) 88
BstDEI CTNAG 1 cut(s) 131
BstKTI GATC 1 cut(s) 130
BstMBI GATC 1 cut(s) 127
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstNI CCWGG 1 cut(s) 10
BstSCI CCNGG 1 cut(s) 8
BstX2I RGATCY 1 cut(s) 127
BstYI RGATCY 1 cut(s) 127
BsuRI GGCC 2 cut(s) 143, 191
BtsIMutI CAGTG 1 cut(s) 122
Cfr13I GGNCC 4 cut(s) 37, 74, 82, 189
CviAII CATG 1 cut(s) 203
CviJI RGCY 8 cut(s) 5, 26, 135, 143, 191, 220, 244, 267
CviKI_1 RGCY 8 cut(s) 5, 26, 135, 143, 191, 220, 244, 267
DdeI CTNAG 1 cut(s) 131
DpnI GATC 1 cut(s) 129
DpnII GATC 1 cut(s) 127
DriI GACNNNNNGTC 1 cut(s) 80
Eam1104I CTCTTC 2 cut(s) 170, 175
Eam1105I GACNNNNNGTC 1 cut(s) 80
EarI CTCTTC 2 cut(s) 170, 175
EciI GGCGGA 1 cut(s) 50
Eco130I CCWWGG 1 cut(s) 210
Eco47I GGWCC 3 cut(s) 37, 74, 82
EcoRI GAATTC 1 cut(s) 13
EcoRII CCWGG 1 cut(s) 8
EcoT14I CCWWGG 1 cut(s) 210
ErhI CCWWGG 1 cut(s) 210
FaeI CATG 1 cut(s) 206
FaiI YATR 3 cut(s) 155, 186, 204
FalI AAGNNNNNCTT 2 cut(s) 141, 173
FatI CATG 1 cut(s) 202
FspBI CTAG 1 cut(s) 245
HaeIII GGCC 2 cut(s) 143, 191
Hin1II CATG 1 cut(s) 206
HphI GGTGA 1 cut(s) 226
Hpy166II GTNNAC 2 cut(s) 74, 85
Hpy188I TCNGA 1 cut(s) 94
Hpy8I GTNNAC 2 cut(s) 74, 85
HpyAV CCTTC 1 cut(s) 257
HpyCH4III ACNGT 1 cut(s) 31
HpyCH4IV ACGT 1 cut(s) 87
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
HpyF3I CTNAG 1 cut(s) 131
HpySE526I ACGT 1 cut(s) 87
Hsp92II CATG 1 cut(s) 206
Kzo9I GATC 1 cut(s) 127
LpnPI CCDG 2 cut(s) 22, 110
MaeI CTAG 1 cut(s) 245
MaeII ACGT 1 cut(s) 87
MaeIII GTNAC 1 cut(s) 233
MalI GATC 1 cut(s) 129
MboI GATC 1 cut(s) 127
MboII GAAGA 4 cut(s) 152, 157, 162, 169
MflI RGATCY 1 cut(s) 127
MluCI AATT 3 cut(s) 13, 54, 58
MnlI CCTC 2 cut(s) 51, 241
MseI TTAA 3 cut(s) 57, 62, 99
MslI CAYNNNNRTG 1 cut(s) 201
MspR9I CCNGG 1 cut(s) 10
MvaI CCWGG 1 cut(s) 10
MwoI GCNNNNNNNGC 1 cut(s) 32
NdeII GATC 1 cut(s) 127
NlaIII CATG 1 cut(s) 206
NlaIV GGNNCC 2 cut(s) 39, 253
NmeAIII GCCGAG 1 cut(s) 169
PfoI TCCNGGA 1 cut(s) 8
Ppu21I YACGTR 1 cut(s) 88
PshBI ATTAAT 1 cut(s) 57
Psp6I CCWGG 1 cut(s) 8
PspGI CCWGG 1 cut(s) 8
PspN4I GGNNCC 2 cut(s) 39, 253
PspPI GGNCC 4 cut(s) 37, 74, 82, 189
PsrI GAACNNNNNNTAC 2 cut(s) 103, 135
PsuI RGATCY 1 cut(s) 127
RseI CAYNNNNRTG 1 cut(s) 201
SaqAI TTAA 3 cut(s) 57, 62, 99
Sau3AI GATC 1 cut(s) 127
Sau96I GGNCC 4 cut(s) 37, 74, 82, 189
ScrFI CCNGG 1 cut(s) 10
SetI ASST 4 cut(s) 28, 90, 154, 246
SinI GGWCC 3 cut(s) 37, 74, 82
SmiMI CAYNNNNRTG 1 cut(s) 201
Sse9I AATT 3 cut(s) 13, 54, 58
SsiI CCGC 1 cut(s) 35
SspMI CTAG 1 cut(s) 245
StyD4I CCNGG 1 cut(s) 8
StyI CCWWGG 1 cut(s) 210
TaaI ACNGT 1 cut(s) 31
TaiI ACGT 1 cut(s) 90
TasI AATT 3 cut(s) 13, 54, 58
Tru1I TTAA 3 cut(s) 57, 62, 99
Tru9I TTAA 3 cut(s) 57, 62, 99
TscAI CASTG 1 cut(s) 129
TspRI CASTG 1 cut(s) 129
VpaK11BI GGWCC 3 cut(s) 37, 74, 82
VspI ATTAAT 1 cut(s) 57
XapI RAATTY 1 cut(s) 13
XspI CTAG 1 cut(s) 245
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.