Prupe.1G486100_v2.0.a1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
OG0016763
Physical Location & Seq
Forward (+)
40477421 .. 40478090
670 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G486100.1

Sequence Viewer

Length: 465 bp
ATGGCAAACCCACCTGAGAAATTGGCCTCAATTCACGAAGTTTCTACACCACCGGAAGAGAGTTATGATGACTTTGATGAGGAAGAAATAGCTCCATCTTCTTCTTGTGGTTGTTTATGGGGATTTTATTTTAGAGCACTGCGTGGAAGAAGCAACATTGGAACACAGAGATATCTACTGCAACAACAAGGAGGAGATCAAGTAAAAGAAAATTGGTTGGTGGAGAATGCGAAGAAAGTACGAGAGTTTTCGGAGGTTTTGGCAGGACCAAAGTGGAAGAATTTCATCCGCTCCTTCAGTACAATTTACAAGAAAAGAAGGGTGCAATTTCAGTATGATCTGCAAAGCTATGCGCTTAATTTCGACGATGGGGGGTTTGACAGGGAAATAGAGGGTAATTCTTATCTTCATTTTTCGAATGCCGGATATGCATCTTGTCCAGGGATGAACAATGCCAAGTTCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

155

Amino Acids

17.67

Weight (kDa)

5.45

Isoelectric Point (pI)

71.01

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0016763)

Species Orthologous Gene IDs
fragaria_vesca FvH4_2g28310
malus_domestica MD15G1130700.v1.1
prunus_persica Prupe.1G486100_v2.0.a1
pyrus_communis pycom08g13290 pycom15g11780
rosa_chinensis RchiOBHm_Chr6g0297221
rosa_laevigata RLG00000011620
rosa_multiflora Rmu_sc0013249.1_g000002
rosa_roxburghii Rroxscaffold_7G00170770
rosa_rugosa Rorug06G0270000
rosa_samantha Rh6AG381100 Rh6BG389300 Rh6CG394500 Rh6DG381200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 291
AciI CCGC 1 cut(s) 289
AcsI RAATTY 1 cut(s) 280
AcuI CTGAAG 1 cut(s) 280
AdeI CACNNNGTG 1 cut(s) 143
AfaI GTAC 2 cut(s) 240, 301
AjnI CCWGG 1 cut(s) 439
AluBI AGCT 2 cut(s) 92, 348
AluI AGCT 2 cut(s) 92, 348
Alw21I GWGCWC 1 cut(s) 139
AoxI GGCC 1 cut(s) 24
ApoI RAATTY 1 cut(s) 280
Asp700I GAANNNNTTC 1 cut(s) 281
AspLEI GCGC 1 cut(s) 355
AspS9I GGNCC 1 cut(s) 266
AsuII TTCGAA 1 cut(s) 416
AvaII GGWCC 1 cut(s) 266
Bbv12I GWGCWC 1 cut(s) 139
BccI CCATC 2 cut(s) 103, 362
BciT130I CCWGG 1 cut(s) 441
Bme1390I CCNGG 1 cut(s) 441
Bme18I GGWCC 1 cut(s) 266
BmgT120I GGNCC 1 cut(s) 266
BmrFI CCNGG 1 cut(s) 441
BmsI GCATC 1 cut(s) 440
Bpu14I TTCGAA 1 cut(s) 416
BsaBI GATNNNNATC 1 cut(s) 430
BsaJI CCNNGG 1 cut(s) 440
BsaWI WCCGGW 1 cut(s) 52
BsaXI ACNNNNNCTCC 2 cut(s) 186, 216
Bse8I GATNNNNATC 1 cut(s) 430
BseBI CCWGG 1 cut(s) 441
BseDI CCNNGG 1 cut(s) 440
BseGI GGATG 2 cut(s) 285, 450
BseJI GATNNNNATC 1 cut(s) 430
BseMII CTCAG 1 cut(s) 6
BseRI GAGGAG 1 cut(s) 207
BshFI GGCC 1 cut(s) 26
BsiHKAI GWGCWC 1 cut(s) 139
BsiSI CCGG 2 cut(s) 53, 423
BsmI GAATGC 2 cut(s) 232, 424
BsnI GGCC 1 cut(s) 26
Bsp119I TTCGAA 1 cut(s) 416
Bsp1286I GDGCHC 1 cut(s) 139
Bsp143I GATC 2 cut(s) 196, 337
BspACI CCGC 1 cut(s) 289
BspANI GGCC 1 cut(s) 26
BspCNI CTCAG 1 cut(s) 7
BspT104I TTCGAA 1 cut(s) 416
BsrBI CCGCTC 1 cut(s) 291
BssECI CCNNGG 1 cut(s) 440
BssMI GATC 2 cut(s) 196, 337
Bst2UI CCWGG 1 cut(s) 441
Bst6I CTCTTC 1 cut(s) 51
BstBI TTCGAA 1 cut(s) 416
BstDEI CTNAG 1 cut(s) 15
BstF5I GGATG 2 cut(s) 285, 450
BstHHI GCGC 1 cut(s) 355
BstKTI GATC 2 cut(s) 199, 340
BstMBI GATC 2 cut(s) 196, 337
BstMWI GCNNNNNNNGC 1 cut(s) 428
BstNI CCWGG 1 cut(s) 441
BstSCI CCNGG 1 cut(s) 439
BsuRI GGCC 1 cut(s) 26
BtsCI GGATG 2 cut(s) 285, 450
BtsI GCAGTG 1 cut(s) 137
BtsIMutI CAGTG 1 cut(s) 137
CfoI GCGC 1 cut(s) 355
Cfr13I GGNCC 1 cut(s) 266
Csp6I GTAC 2 cut(s) 239, 300
CviJI RGCY 3 cut(s) 26, 92, 348
CviKI_1 RGCY 3 cut(s) 26, 92, 348
CviQI GTAC 2 cut(s) 239, 300
DdeI CTNAG 1 cut(s) 15
DpnI GATC 2 cut(s) 198, 339
DpnII GATC 2 cut(s) 196, 337
DraIII CACNNNGTG 1 cut(s) 143
Eam1104I CTCTTC 1 cut(s) 51
EarI CTCTTC 1 cut(s) 51
Eco32I GATATC 1 cut(s) 173
Eco47I GGWCC 1 cut(s) 266
Eco57I CTGAAG 1 cut(s) 280
EcoRII CCWGG 1 cut(s) 439
EcoRV GATATC 1 cut(s) 173
EcoT22I ATGCAT 1 cut(s) 433
FaiI YATR 5 cut(s) 66, 118, 336, 351, 429
FokI GGATG 2 cut(s) 272, 457
GlaI GCGC 1 cut(s) 354
HaeIII GGCC 1 cut(s) 26
HapII CCGG 2 cut(s) 53, 423
HhaI GCGC 1 cut(s) 355
Hin6I GCGC 1 cut(s) 353
HinP1I GCGC 1 cut(s) 353
HpaII CCGG 2 cut(s) 53, 423
Hpy188I TCNGA 2 cut(s) 253, 464
Hpy188III TCNNGA 1 cut(s) 35
Hpy99I CGWCG 1 cut(s) 368
HpyAV CCTTC 2 cut(s) 304, 312
HpyCH4V TGCA 4 cut(s) 181, 325, 343, 431
HpyF10VI GCNNNNNNNGC 1 cut(s) 428
HpyF3I CTNAG 1 cut(s) 15
HspAI GCGC 1 cut(s) 353
Kzo9I GATC 2 cut(s) 196, 337
LmnI GCTCC 2 cut(s) 97, 296
LpnPI CCDG 7 cut(s) 27, 66, 249, 367, 426, 436, 453
LweI GCATC 1 cut(s) 440
MalI GATC 2 cut(s) 198, 339
MbiI CCGCTC 1 cut(s) 291
MboI GATC 2 cut(s) 196, 337
MboII GAAGA 8 cut(s) 68, 90, 93, 95, 159, 244, 289, 398
MhlI GDGCHC 1 cut(s) 139
MluCI AATT 8 cut(s) 20, 30, 211, 280, 303, 326, 358, 397
MnlI CCTC 5 cut(s) 37, 73, 185, 247, 385
Mph1103I ATGCAT 1 cut(s) 433
MroXI GAANNNNTTC 1 cut(s) 281
MseI TTAA 1 cut(s) 357
MspI CCGG 2 cut(s) 53, 423
MspR9I CCNGG 1 cut(s) 441
Mva1269I GAATGC 2 cut(s) 232, 424
MvaI CCWGG 1 cut(s) 441
MwoI GCNNNNNNNGC 1 cut(s) 428
NdeII GATC 2 cut(s) 196, 337
NsiI ATGCAT 1 cut(s) 433
NspV TTCGAA 1 cut(s) 416
PctI GAATGC 2 cut(s) 232, 424
PdmI GAANNNNTTC 1 cut(s) 281
Psp6I CCWGG 1 cut(s) 439
PspGI CCWGG 1 cut(s) 439
PspPI GGNCC 1 cut(s) 266
RsaI GTAC 2 cut(s) 240, 301
RsaNI GTAC 2 cut(s) 239, 300
SaqAI TTAA 1 cut(s) 357
Sau3AI GATC 2 cut(s) 196, 337
Sau96I GGNCC 1 cut(s) 266
ScrFI CCNGG 1 cut(s) 441
SduI GDGCHC 1 cut(s) 139
SetI ASST 4 cut(s) 16, 94, 258, 350
SfaNI GCATC 1 cut(s) 440
SfuI TTCGAA 1 cut(s) 416
SinI GGWCC 1 cut(s) 266
Sse9I AATT 8 cut(s) 20, 30, 211, 280, 303, 326, 358, 397
SsiI CCGC 1 cut(s) 289
StyD4I CCNGG 1 cut(s) 439
TaqI TCGA 2 cut(s) 363, 416
TasI AATT 8 cut(s) 20, 30, 211, 280, 303, 326, 358, 397
TatI WGTACW 1 cut(s) 299
Tru1I TTAA 1 cut(s) 357
Tru9I TTAA 1 cut(s) 357
TscAI CASTG 1 cut(s) 144
TspDTI ATGAA 3 cut(s) 274, 398, 461
TspRI CASTG 1 cut(s) 144
VpaK11BI GGWCC 1 cut(s) 266
XapI RAATTY 1 cut(s) 280
XmnI GAANNNNTTC 1 cut(s) 281
Zsp2I ATGCAT 1 cut(s) 433
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.