Prupe.2G297100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp02
Physical Location & Seq
Reverse (-)
28742209 .. 28742400
192 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.2G297100.1

Sequence Viewer

Length: 192 bp
ATGGACGAGAGGGCTTCGGAAACAAAGAACATCGAGAGGAAGAAGATAATGTCTGCGTGCGATGTTGAGGCCCTGAAGAAATGCTTGGAGGAGAACAAAGGGGACTACGTCAAGTGCCAGTCACAGATAGAGGCCTTCAAATCTTCATGTGCTTTAAAGAAGCCAAACCCATCTCTAGCATCTGTGCCATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

64

Amino Acids

7.02

Weight (kDa)

8.38

Isoelectric Point (pI)

76.11

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018878)

Species Orthologous Gene IDs
fragaria_vesca FvH4_7g29780
prunus_persica Prupe.2G297100_v2.0.a1
pyrus_communis pycom01g21430
rosa_chinensis RchiOBHm_Chr1g0377781
rosa_laevigata RLG00000026499
rosa_samantha Rh1BG381900 Rh1CG395800 Rh1DG412900
rosa_wichuraiana Rw1G037120

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 95
AgsI TTSAA 1 cut(s) 139
AjuI GAANNNNNNNTTGG 2 cut(s) 68, 100
AoxI GGCC 2 cut(s) 69, 132
AspS9I GGNCC 1 cut(s) 70
BccI CCATC 1 cut(s) 178
BfaI CTAG 1 cut(s) 176
BmgT120I GGNCC 1 cut(s) 70
BmsI GCATC 1 cut(s) 188
Bse1I ACTGG 1 cut(s) 118
BseNI ACTGG 1 cut(s) 118
BseRI GAGGAG 1 cut(s) 104
BshFI GGCC 2 cut(s) 71, 134
BslFI GGGAC 1 cut(s) 116
BsmFI GGGAC 1 cut(s) 116
BsnI GGCC 2 cut(s) 71, 134
BspANI GGCC 2 cut(s) 71, 134
BsrI ACTGG 1 cut(s) 118
BstC8I GCNNGC 1 cut(s) 58
BsuRI GGCC 2 cut(s) 71, 134
BtgZI GCGATG 1 cut(s) 75
Cac8I GCNNGC 1 cut(s) 58
Cfr13I GGNCC 1 cut(s) 70
CviAII CATG 1 cut(s) 147
CviJI RGCY 4 cut(s) 14, 71, 134, 163
CviKI_1 RGCY 4 cut(s) 14, 71, 134, 163
DraI TTTAAA 1 cut(s) 156
Eco147I AGGCCT 1 cut(s) 134
Eco57I CTGAAG 1 cut(s) 95
EcoO109I RGGNCCY 1 cut(s) 70
FaeI CATG 1 cut(s) 150
FaiI YATR 2 cut(s) 148, 190
FalI AAGNNNNNCTT 2 cut(s) 68, 100
FaqI GGGAC 1 cut(s) 116
FatI CATG 1 cut(s) 146
FspBI CTAG 1 cut(s) 176
HaeIII GGCC 2 cut(s) 71, 134
Hin1II CATG 1 cut(s) 150
Hpy188I TCNGA 1 cut(s) 19
Hpy188III TCNNGA 1 cut(s) 34
HpyAV CCTTC 1 cut(s) 145
HpyCH4IV ACGT 1 cut(s) 108
HpySE526I ACGT 1 cut(s) 108
Hsp92II CATG 1 cut(s) 150
LpnPI CCDG 2 cut(s) 86, 131
LweI GCATC 1 cut(s) 188
MaeI CTAG 1 cut(s) 176
MaeII ACGT 1 cut(s) 108
MaeIII GTNAC 1 cut(s) 120
MboII GAAGA 4 cut(s) 52, 55, 88, 135
MnlI CCTC 5 cut(s) 3, 30, 61, 82, 124
MseI TTAA 1 cut(s) 155
NlaIII CATG 1 cut(s) 150
NmuCI GTSAC 1 cut(s) 120
PceI AGGCCT 1 cut(s) 134
PflFI GACNNNGTC 1 cut(s) 107
PspPI GGNCC 1 cut(s) 70
PsyI GACNNNGTC 1 cut(s) 107
SaqAI TTAA 1 cut(s) 155
Sau96I GGNCC 1 cut(s) 70
SetI ASST 1 cut(s) 111
SfaNI GCATC 1 cut(s) 188
SgeI CNNG 9 cut(s) 19, 46, 69, 85, 97, 124, 130, 159, 188
SseBI AGGCCT 1 cut(s) 134
SspMI CTAG 1 cut(s) 176
StuI AGGCCT 1 cut(s) 134
TaiI ACGT 1 cut(s) 111
TaqI TCGA 1 cut(s) 33
Tru1I TTAA 1 cut(s) 155
Tru9I TTAA 1 cut(s) 155
TseFI GTSAC 1 cut(s) 120
Tsp45I GTSAC 1 cut(s) 120
TspDTI ATGAA 1 cut(s) 135
Tth111I GACNNNGTC 1 cut(s) 107
XspI CTAG 1 cut(s) 176
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.