Prupe.5G213300_v2.0.a1

Plant family of unknown function (DUF810)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp05
OG0019804
Physical Location & Seq
Reverse (-)
16861740 .. 16862594
855 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.5G213300.1_v2.0.a1.CDS.1

Sequence Viewer

Length: 720 bp
ATGTGTCATGTGTGGCCACTTCCTACATTGTGCAACATCCAACTCCCTCCCGATCTCAAGTACGTCCAGGCCAAGCCAATTACAGTTAACCCTCCTCCTCCTCCGTTGTCTTCAAATAGAATAGAGATGGAATATCGGTGTCATTGGAACAACAGAAGCCGTAGCCAAGGAGATAGAAATTACAGAAAGCCGTGCAGGACAAGCAGTGACGATCATGATGATCATGATAATGATGCAAAGGTGCAGGCCATTAGATCTGGAGGTACTGATGCGGATGCTGCTGCTGCTGCTGATGATGATGATATGGGCTTGGAGAGAGCAAAGAAATTATTGGCTACGCTTCAAAATAAAAAGATGATCAAAGATATTCACCACAAGGATCATGATCATGATCATACAGCAGCAGCTGCTTATTCTACTACTAGTCCACAAGCAATTCCCTCCTTTGCAACTGCAGATCAAAAGAACAACAATATTCATGAAATCCCGTCCTCCTCAACTACATGTCCTACTTGTTGTTTGCCCAAGGAACCCAAACTTGTCTTTTCAGAGATACGGACATTCGTTGAAGGTCCCCACTTTGAGAAACAAGAATCCCGCTTCATCAAACGAAAGAAGAAGATTGAAAAGATTAAGGCTGAAGAACAAAAGGCAAGAGAATATGCTCTGGAGGTGCTTGCAAAGCTAGTGCCTTCCCATATTAAATTTACAGTCCTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF810

Protein Analysis

240

Amino Acids

27.04

Weight (kDa)

8.4

Isoelectric Point (pI)

55.57

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0019804)

Species Orthologous Gene IDs
prunus_persica Prupe.5G213300_v2.0.a1 Prupe.5G213400_v2.0.a1
rosa_rugosa Rorug03G0249500 Rorug03G0249600
rosa_samantha Rh1AG236800 Rh1BG083700 Rh2AG321200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 272, 598
AclWI GGATC 1 cut(s) 387
AcoI YGGCCR 1 cut(s) 14
AcsI RAATTY 1 cut(s) 704
AcuI CTGAAG 1 cut(s) 660
AfaI GTAC 2 cut(s) 62, 265
AflIII ACRYGT 1 cut(s) 503
AgsI TTSAA 4 cut(s) 114, 344, 569, 626
AhlI ACTAGT 1 cut(s) 422
AjnI CCWGG 1 cut(s) 66
AluBI AGCT 2 cut(s) 407, 685
AluI AGCT 2 cut(s) 407, 685
AlwI GGATC 1 cut(s) 387
AlwNI CAGNNNCTG 1 cut(s) 407
AoxI GGCC 3 cut(s) 14, 69, 246
ApeKI GCWGC 7 cut(s) 278, 281, 284, 287, 401, 404, 407
ApoI RAATTY 1 cut(s) 704
AspS9I GGNCC 1 cut(s) 572
AsuHPI GGTGA 1 cut(s) 362
AvaII GGWCC 1 cut(s) 572
BalI TGGCCA 1 cut(s) 16
BbsI GAAGAC 1 cut(s) 102
BbvI GCAGC 7 cut(s) 265, 268, 271, 274, 394, 413, 416
BccI CCATC 1 cut(s) 121
BceAI ACGGC 2 cut(s) 144, 175
BciT130I CCWGG 1 cut(s) 68
BclI TGATCA 4 cut(s) 220, 357, 385, 391
BcuI ACTAGT 1 cut(s) 422
BfaI CTAG 2 cut(s) 423, 686
BfmI CTRYAG 1 cut(s) 453
BglII AGATCT 1 cut(s) 254
BisI GCNGC 7 cut(s) 279, 282, 285, 288, 402, 405, 408
BlsI GCNGC 7 cut(s) 280, 283, 286, 289, 403, 406, 409
Bme1390I CCNGG 1 cut(s) 68
Bme18I GGWCC 1 cut(s) 572
BmgT120I GGNCC 1 cut(s) 572
BmiI GGNNCC 2 cut(s) 531, 574
BmrFI CCNGG 1 cut(s) 68
BmsI GCATC 3 cut(s) 223, 259, 265
BpiI GAAGAC 1 cut(s) 102
BpmI CTGGAG 2 cut(s) 279, 689
BpuEI CTTGAG 1 cut(s) 41
BsaBI GATNNNNATC 2 cut(s) 384, 390
BsaJI CCNNGG 2 cut(s) 166, 525
Bse8I GATNNNNATC 2 cut(s) 384, 390
BseBI CCWGG 1 cut(s) 68
BseDI CCNNGG 2 cut(s) 166, 525
BseGI GGATG 2 cut(s) 36, 280
BseJI GATNNNNATC 2 cut(s) 384, 390
BseRI GAGGAG 4 cut(s) 84, 87, 90, 484
BseXI GCAGC 7 cut(s) 265, 268, 271, 274, 394, 413, 416
BsgI GTGCAG 2 cut(s) 214, 263
BshFI GGCC 3 cut(s) 16, 71, 248
BslFI GGGAC 1 cut(s) 558
BsmFI GGGAC 1 cut(s) 558
BsnI GGCC 3 cut(s) 16, 71, 248
Bsp143I GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
BspACI CCGC 2 cut(s) 272, 598
BspANI GGCC 3 cut(s) 16, 71, 248
BspHI TCATGA 5 cut(s) 214, 223, 382, 388, 478
BspLI GGNNCC 2 cut(s) 531, 574
BspMAI CTGCAG 1 cut(s) 457
BspPI GGATC 1 cut(s) 387
BssECI CCNNGG 2 cut(s) 166, 525
BssMI GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
BssT1I CCWWGG 2 cut(s) 166, 525
Bst2UI CCWGG 1 cut(s) 68
Bst4CI ACNGT 2 cut(s) 85, 712
BstAPI GCANNNNNTGC 1 cut(s) 407
BstC8I GCNNGC 2 cut(s) 246, 678
BstF5I GGATG 2 cut(s) 36, 280
BstKTI GATC 9 cut(s) 55, 214, 223, 257, 360, 382, 388, 394, 460
BstMBI GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
BstMWI GCNNNNNNNGC 6 cut(s) 201, 278, 284, 287, 407, 682
BstNI CCWGG 1 cut(s) 68
BstNSI RCATGY 1 cut(s) 507
BstSCI CCNGG 1 cut(s) 66
BstSFI CTRYAG 1 cut(s) 453
BstV1I GCAGC 7 cut(s) 265, 268, 271, 274, 394, 413, 416
BstV2I GAAGAC 1 cut(s) 102
BstX2I RGATCY 1 cut(s) 254
BstYI RGATCY 1 cut(s) 254
BsuRI GGCC 3 cut(s) 16, 71, 248
BtsCI GGATG 2 cut(s) 36, 280
BtsI GCAGTG 1 cut(s) 211
BtsIMutI CAGTG 1 cut(s) 211
Cac8I GCNNGC 2 cut(s) 246, 678
CaiI CAGNNNCTG 1 cut(s) 407
CciI TCATGA 5 cut(s) 214, 223, 382, 388, 478
Cfr13I GGNCC 1 cut(s) 572
Csp6I GTAC 2 cut(s) 61, 264
CviAII CATG 7 cut(s) 8, 215, 224, 383, 389, 479, 504
CviQI GTAC 2 cut(s) 61, 264
DpnI GATC 9 cut(s) 54, 213, 222, 256, 359, 381, 387, 393, 459
DpnII GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
EaeI YGGCCR 1 cut(s) 14
Eco130I CCWWGG 2 cut(s) 166, 525
Eco47I GGWCC 1 cut(s) 572
Eco57I CTGAAG 1 cut(s) 660
EcoO109I RGGNCCY 1 cut(s) 572
EcoRII CCWGG 1 cut(s) 66
EcoT14I CCWWGG 2 cut(s) 166, 525
ErhI CCWWGG 2 cut(s) 166, 525
FaeI CATG 7 cut(s) 11, 218, 227, 386, 392, 482, 507
FaqI GGGAC 1 cut(s) 558
FatI CATG 7 cut(s) 7, 214, 223, 382, 388, 478, 503
FauI CCCGC 1 cut(s) 605
FbaI TGATCA 4 cut(s) 220, 357, 385, 391
Fnu4HI GCNGC 7 cut(s) 279, 282, 285, 288, 402, 405, 408
FokI GGATG 2 cut(s) 23, 287
Fsp4HI GCNGC 7 cut(s) 279, 282, 285, 288, 402, 405, 408
FspBI CTAG 2 cut(s) 423, 686
GluI GCNGC 7 cut(s) 279, 282, 285, 288, 402, 405, 408
GsuI CTGGAG 2 cut(s) 279, 689
HaeIII GGCC 3 cut(s) 16, 71, 248
Hin1II CATG 7 cut(s) 11, 218, 227, 386, 392, 482, 507
HincII GTYRAC 1 cut(s) 88
HindII GTYRAC 1 cut(s) 88
HinfI GANTC 1 cut(s) 593
HpaI GTTAAC 1 cut(s) 88
HphI GGTGA 1 cut(s) 362
Hpy166II GTNNAC 2 cut(s) 88, 428
Hpy188I TCNGA 1 cut(s) 550
Hpy188III TCNNGA 8 cut(s) 50, 215, 224, 258, 383, 389, 479, 668
Hpy8I GTNNAC 2 cut(s) 88, 428
HpyAV CCTTC 2 cut(s) 563, 702
HpyCH4III ACNGT 2 cut(s) 85, 712
HpyCH4IV ACGT 1 cut(s) 63
HpyCH4V TGCA 7 cut(s) 33, 195, 236, 244, 449, 455, 680
HpyF10VI GCNNNNNNNGC 6 cut(s) 201, 278, 284, 287, 407, 682
HpySE526I ACGT 1 cut(s) 63
Hsp92II CATG 7 cut(s) 11, 218, 227, 386, 392, 482, 507
Ksp22I TGATCA 4 cut(s) 220, 357, 385, 391
KspAI GTTAAC 1 cut(s) 88
Kzo9I GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
LpnPI CCDG 6 cut(s) 53, 80, 181, 230, 243, 653
Lsp1109I GCAGC 7 cut(s) 265, 268, 271, 274, 394, 413, 416
LweI GCATC 3 cut(s) 223, 259, 265
MaeI CTAG 2 cut(s) 423, 686
MaeII ACGT 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 206
MalI GATC 9 cut(s) 54, 213, 222, 256, 359, 381, 387, 393, 459
MboI GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
MboII GAAGA 4 cut(s) 102, 628, 631, 653
MflI RGATCY 1 cut(s) 254
MlsI TGGCCA 1 cut(s) 16
MluCI AATT 5 cut(s) 78, 178, 326, 435, 704
MluNI TGGCCA 1 cut(s) 16
MmeI TCCRAC 1 cut(s) 64
Mox20I TGGCCA 1 cut(s) 16
MscI TGGCCA 1 cut(s) 16
MseI TTAA 3 cut(s) 87, 633, 702
MslI CAYNNNNRTG 2 cut(s) 228, 387
Msp20I TGGCCA 1 cut(s) 16
MspA1I CMGCKG 1 cut(s) 407
MspR9I CCNGG 1 cut(s) 68
MvaI CCWGG 1 cut(s) 68
MwoI GCNNNNNNNGC 6 cut(s) 201, 278, 284, 287, 407, 682
NdeII GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
NlaIII CATG 7 cut(s) 11, 218, 227, 386, 392, 482, 507
NlaIV GGNNCC 2 cut(s) 531, 574
NmuCI GTSAC 1 cut(s) 206
NspI RCATGY 1 cut(s) 507
PagI TCATGA 5 cut(s) 214, 223, 382, 388, 478
PciI ACATGT 1 cut(s) 503
PfeI GAWTC 1 cut(s) 593
PkrI GCNGC 7 cut(s) 280, 283, 286, 289, 403, 406, 409
PpuMI RGGWCCY 1 cut(s) 572
PscI ACATGT 1 cut(s) 503
Psp5II RGGWCCY 1 cut(s) 572
Psp6I CCWGG 1 cut(s) 66
PspGI CCWGG 1 cut(s) 66
PspN4I GGNNCC 2 cut(s) 531, 574
PspPI GGNCC 1 cut(s) 572
PspPPI RGGWCCY 1 cut(s) 572
PstI CTGCAG 1 cut(s) 457
PstNI CAGNNNCTG 1 cut(s) 407
PsuI RGATCY 1 cut(s) 254
PvuII CAGCTG 1 cut(s) 407
RsaI GTAC 2 cut(s) 62, 265
RsaNI GTAC 2 cut(s) 61, 264
RseI CAYNNNNRTG 2 cut(s) 228, 387
SaqAI TTAA 3 cut(s) 87, 633, 702
SatI GCNGC 7 cut(s) 279, 282, 285, 288, 402, 405, 408
Sau3AI GATC 9 cut(s) 52, 211, 220, 254, 357, 379, 385, 391, 457
Sau96I GGNCC 1 cut(s) 572
ScrFI CCNGG 1 cut(s) 68
SetI ASST 7 cut(s) 66, 243, 265, 409, 574, 675, 687
SfaNI GCATC 3 cut(s) 223, 259, 265
SfcI CTRYAG 1 cut(s) 453
SinI GGWCC 1 cut(s) 572
SmiMI CAYNNNNRTG 2 cut(s) 228, 387
SmlI CTYRAG 1 cut(s) 56
SmoI CTYRAG 1 cut(s) 56
SpeI ACTAGT 1 cut(s) 422
Sse9I AATT 5 cut(s) 78, 178, 326, 435, 704
SsiI CCGC 2 cut(s) 272, 598
SspI AATATT 1 cut(s) 475
SspMI CTAG 2 cut(s) 423, 686
StyD4I CCNGG 1 cut(s) 66
StyI CCWWGG 2 cut(s) 166, 525
TaaI ACNGT 2 cut(s) 85, 712
TaiI ACGT 1 cut(s) 66
TasI AATT 5 cut(s) 78, 178, 326, 435, 704
TfiI GAWTC 1 cut(s) 593
Tru1I TTAA 3 cut(s) 87, 633, 702
Tru9I TTAA 3 cut(s) 87, 633, 702
TscAI CASTG 1 cut(s) 211
TseFI GTSAC 1 cut(s) 206
TseI GCWGC 7 cut(s) 278, 281, 284, 287, 401, 404, 407
Tsp45I GTSAC 1 cut(s) 206
TspDTI ATGAA 3 cut(s) 467, 495, 592
TspGWI ACGGA 2 cut(s) 93, 571
TspRI CASTG 1 cut(s) 211
VpaK11BI GGWCC 1 cut(s) 572
XapI RAATTY 1 cut(s) 704
XceI RCATGY 1 cut(s) 507
XspI CTAG 2 cut(s) 423, 686
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.