Prupe.6G236900_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
23744662 .. 23745450
789 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G236900.1

Sequence Viewer

Length: 141 bp
ATGGCTAAGGAGATGAAGAATTTGACTGGATGGATGGAGGTTCTTCCAGCCCCCATCATTTACCCACAAAAGCCTTCGAATTCCCCTGGTTTGGAGACAATTTTCGAAGAGAGCATCGAAGAATCTGACGACGATTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

47

Amino Acids

5.17

Weight (kDa)

4.05

Isoelectric Point (pI)

86.27

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018727)

Species Orthologous Gene IDs
arabidopsis_thaliana AT5G03210 AT5G03210
prunus_persica Prupe.6G236900_v2.0.a1
rosa_chinensis RchiOBHm_Chr3g0469561 RchiOBHm_Chr3g0469571
rosa_multiflora Rmu_sc0006483.1_g000004
rosa_rugosa Rorug03G0102600
rosa_samantha Rh3AG151900 Rh3DG199900

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 2 cut(s) 19, 79
AfiI CCNNNNNNNGG 1 cut(s) 91
AjnI CCWGG 1 cut(s) 85
Alw26I GTCTC 1 cut(s) 89
ApoI RAATTY 2 cut(s) 19, 79
AsuII TTCGAA 2 cut(s) 77, 105
BccI CCATC 3 cut(s) 24, 28, 62
BciT130I CCWGG 1 cut(s) 87
BcoDI GTCTC 1 cut(s) 89
Bme1390I CCNGG 1 cut(s) 87
BmrFI CCNGG 1 cut(s) 87
BmsI GCATC 1 cut(s) 123
Bpu10I CCTNAGC 1 cut(s) 6
Bpu14I TTCGAA 2 cut(s) 77, 105
BsaJI CCNNGG 1 cut(s) 85
Bsc4I CCNNNNNNNGG 1 cut(s) 91
Bse1I ACTGG 1 cut(s) 31
BseBI CCWGG 1 cut(s) 87
BseDI CCNNGG 1 cut(s) 85
BseGI GGATG 2 cut(s) 35, 39
BseLI CCNNNNNNNGG 1 cut(s) 91
BseNI ACTGG 1 cut(s) 31
BslI CCNNNNNNNGG 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 89
Bsp119I TTCGAA 2 cut(s) 77, 105
BspT104I TTCGAA 2 cut(s) 77, 105
BsrI ACTGG 1 cut(s) 31
BssECI CCNNGG 1 cut(s) 85
Bst2UI CCWGG 1 cut(s) 87
Bst6I CTCTTC 1 cut(s) 102
BstBI TTCGAA 2 cut(s) 77, 105
BstDEI CTNAG 1 cut(s) 6
BstF5I GGATG 2 cut(s) 35, 39
BstMAI GTCTC 1 cut(s) 89
BstNI CCWGG 1 cut(s) 87
BstSCI CCNGG 1 cut(s) 85
BtsCI GGATG 2 cut(s) 35, 39
CviJI RGCY 3 cut(s) 5, 50, 73
CviKI_1 RGCY 3 cut(s) 5, 50, 73
DdeI CTNAG 1 cut(s) 6
Eam1104I CTCTTC 1 cut(s) 102
EarI CTCTTC 1 cut(s) 102
EcoRI GAATTC 1 cut(s) 79
EcoRII CCWGG 1 cut(s) 85
FaiI YATR 1 cut(s) 139
FokI GGATG 2 cut(s) 42, 46
HinfI GANTC 2 cut(s) 122, 134
Hpy188I TCNGA 1 cut(s) 127
Hpy99I CGWCG 1 cut(s) 134
HpyAV CCTTC 1 cut(s) 84
HpyF3I CTNAG 1 cut(s) 6
LpnPI CCDG 4 cut(s) 12, 60, 72, 99
LweI GCATC 1 cut(s) 123
MboII GAAGA 4 cut(s) 28, 35, 119, 131
MluCI AATT 3 cut(s) 19, 79, 99
MnlI CCTC 1 cut(s) 31
MspR9I CCNGG 1 cut(s) 87
MvaI CCWGG 1 cut(s) 87
NspV TTCGAA 2 cut(s) 77, 105
PfeI GAWTC 2 cut(s) 122, 134
Psp6I CCWGG 1 cut(s) 85
PspGI CCWGG 1 cut(s) 85
ScrFI CCNGG 1 cut(s) 87
SetI ASST 1 cut(s) 42
SfaNI GCATC 1 cut(s) 123
SfuI TTCGAA 2 cut(s) 77, 105
SgeI CNNG 4 cut(s) 39, 59, 98, 99
Sse9I AATT 3 cut(s) 19, 79, 99
StyD4I CCNGG 1 cut(s) 85
TaqI TCGA 3 cut(s) 77, 105, 117
TasI AATT 3 cut(s) 19, 79, 99
TfiI GAWTC 2 cut(s) 122, 134
TspDTI ATGAA 2 cut(s) 29, 126
XapI RAATTY 2 cut(s) 19, 79
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.