Prupe.6G326900_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
28702140 .. 28703130
991 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G326900.1

Sequence Viewer

Length: 402 bp
ATGTCCAAAGTCCAAAAGCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCAGCACAAAAAGAAACCCAAAAGTCTGATTTTTATATTCTCCACATGTTGGCTTAAAGAGAAGCTGAACAGAGACAAAAACAATACTTTTGGATCCACAGAAGTTCTGCTCATGCTGCTCATGTCCATGTTCATCTCAAGGAATCAAGTTATTGGTCTTCTGTTCATCTTCCTGGGCATCTCAGGTTTATACACTGGAGTTTCTGGAGCTAGATGTTTAAATGAGAAGGTGGAAAATCCAGAGAAGCCTCAAGTTCTTCAGAGGAAAAGCTCCAGTATTTCTACAGATGAAGGCTTTTTTGCAACAATCAACAGAGAAGTGCCTTCTTCTCCTGACCCATTGCACAATAGGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

134

Amino Acids

14.96

Weight (kDa)

9.83

Isoelectric Point (pI)

35.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018452)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g05720
malus_domestica MD04G1206200.v1.1
prunus_persica Prupe.6G326900_v2.0.a1
pyrus_communis pycom04g18240 pycom12g20560
rosa_chinensis RchiOBHm_Chr3g0454611
rosa_roxburghii Rroxscaffold_6G00424930
rosa_rugosa Rorug03G0000600
rosa_samantha Rh3AG060500 Rh3DG062200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 96
AclWI GGATC 2 cut(s) 135, 148
AcuI CTGAAG 1 cut(s) 290
AfiI CCNNNNNNNGG 1 cut(s) 96
AflIII ACRYGT 1 cut(s) 92
AjnI CCWGG 1 cut(s) 219
AluBI AGCT 4 cut(s) 19, 112, 257, 318
AluI AGCT 4 cut(s) 19, 112, 257, 318
Alw26I GTCTC 1 cut(s) 114
AlwI GGATC 2 cut(s) 135, 148
ApeKI GCWGC 1 cut(s) 163
BamHI GGATCC 1 cut(s) 140
BbsI GAAGAC 1 cut(s) 197
BbvI GCAGC 1 cut(s) 150
BciT130I CCWGG 1 cut(s) 221
BcoDI GTCTC 1 cut(s) 114
BfaI CTAG 1 cut(s) 258
BfmI CTRYAG 1 cut(s) 330
BisI GCNGC 1 cut(s) 164
BlsI GCNGC 1 cut(s) 165
Bme1390I CCNGG 1 cut(s) 221
BmiI GGNNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 221
BmsI GCATC 1 cut(s) 234
BpiI GAAGAC 1 cut(s) 197
BpmI CTGGAG 3 cut(s) 264, 273, 304
BpuEI CTTGAG 2 cut(s) 169, 282
BsaJI CCNNGG 1 cut(s) 220
Bsc4I CCNNNNNNNGG 1 cut(s) 96
Bse1I ACTGG 2 cut(s) 247, 321
Bse3DI GCAATG 1 cut(s) 386
BseBI CCWGG 1 cut(s) 221
BseDI CCNNGG 1 cut(s) 220
BseLI CCNNNNNNNGG 1 cut(s) 96
BseMI GCAATG 1 cut(s) 386
BseMII CTCAG 2 cut(s) 62, 243
BseNI ACTGG 2 cut(s) 247, 321
BseXI GCAGC 1 cut(s) 150
BslI CCNNNNNNNGG 1 cut(s) 96
BsmAI GTCTC 1 cut(s) 114
Bsp143I GATC 1 cut(s) 140
BspCNI CTCAG 2 cut(s) 61, 242
BspLI GGNNCC 1 cut(s) 142
BspPI GGATC 2 cut(s) 135, 148
BsrDI GCAATG 1 cut(s) 386
BsrI ACTGG 2 cut(s) 247, 321
BssECI CCNNGG 1 cut(s) 220
BssMI GATC 1 cut(s) 140
Bst2UI CCWGG 1 cut(s) 221
BstDEI CTNAG 2 cut(s) 48, 229
BstKTI GATC 1 cut(s) 143
BstMAI GTCTC 1 cut(s) 114
BstMBI GATC 1 cut(s) 140
BstMWI GCNNNNNNNGC 1 cut(s) 163
BstNI CCWGG 1 cut(s) 221
BstNSI RCATGY 1 cut(s) 96
BstSCI CCNGG 1 cut(s) 219
BstSFI CTRYAG 1 cut(s) 330
BstV1I GCAGC 1 cut(s) 150
BstV2I GAAGAC 1 cut(s) 197
BstX2I RGATCY 1 cut(s) 140
BstYI RGATCY 1 cut(s) 140
BtsIMutI CAGTG 1 cut(s) 240
CviAII CATG 4 cut(s) 93, 160, 169, 175
CviJI RGCY 7 cut(s) 19, 100, 112, 257, 295, 318, 342
CviKI_1 RGCY 7 cut(s) 19, 100, 112, 257, 295, 318, 342
DdeI CTNAG 2 cut(s) 48, 229
DpnI GATC 1 cut(s) 142
DpnII GATC 1 cut(s) 140
DraI TTTAAA 1 cut(s) 267
Eco57I CTGAAG 1 cut(s) 290
EcoRII CCWGG 1 cut(s) 219
FaeI CATG 4 cut(s) 96, 163, 172, 178
FaiI YATR 6 cut(s) 83, 94, 161, 170, 176, 238
FatI CATG 4 cut(s) 92, 159, 168, 174
Fnu4HI GCNGC 1 cut(s) 164
Fsp4HI GCNGC 1 cut(s) 164
FspBI CTAG 1 cut(s) 258
GluI GCNGC 1 cut(s) 164
GsuI CTGGAG 3 cut(s) 264, 273, 304
Hin1II CATG 4 cut(s) 96, 163, 172, 178
HinfI GANTC 1 cut(s) 190
Hpy188I TCNGA 2 cut(s) 75, 309
Hpy188III TCNNGA 3 cut(s) 252, 287, 380
HpyAV CCTTC 3 cut(s) 268, 332, 381
HpyCH4V TGCA 2 cut(s) 350, 391
HpyF10VI GCNNNNNNNGC 1 cut(s) 163
HpyF3I CTNAG 2 cut(s) 48, 229
Hsp92II CATG 4 cut(s) 96, 163, 172, 178
Kzo9I GATC 1 cut(s) 140
LmnI GCTCC 2 cut(s) 254, 323
LpnPI CCDG 8 cut(s) 206, 216, 228, 233, 237, 300, 334, 393
Lsp1109I GCAGC 1 cut(s) 150
LweI GCATC 1 cut(s) 234
MaeI CTAG 1 cut(s) 258
MalI GATC 1 cut(s) 142
MboI GATC 1 cut(s) 140
MboII GAAGA 4 cut(s) 197, 208, 296, 366
MflI RGATCY 1 cut(s) 140
MnlI CCTC 2 cut(s) 303, 306
MseI TTAA 2 cut(s) 102, 266
MslI CAYNNNNRTG 1 cut(s) 173
MspR9I CCNGG 1 cut(s) 221
MvaI CCWGG 1 cut(s) 221
MwoI GCNNNNNNNGC 1 cut(s) 163
NdeII GATC 1 cut(s) 140
NlaIII CATG 4 cut(s) 96, 163, 172, 178
NlaIV GGNNCC 1 cut(s) 142
NspI RCATGY 1 cut(s) 96
PciI ACATGT 1 cut(s) 92
PfeI GAWTC 1 cut(s) 190
PflMI CCANNNNNTGG 1 cut(s) 96
PkrI GCNGC 1 cut(s) 165
PscI ACATGT 1 cut(s) 92
Psp6I CCWGG 1 cut(s) 219
PspGI CCWGG 1 cut(s) 219
PspN4I GGNNCC 1 cut(s) 142
PsuI RGATCY 1 cut(s) 140
RseI CAYNNNNRTG 1 cut(s) 173
SaqAI TTAA 2 cut(s) 102, 266
SatI GCNGC 1 cut(s) 164
Sau3AI GATC 1 cut(s) 140
ScrFI CCNGG 1 cut(s) 221
SetI ASST 7 cut(s) 21, 114, 235, 259, 279, 320, 401
SfaNI GCATC 1 cut(s) 234
SfcI CTRYAG 1 cut(s) 330
SmiMI CAYNNNNRTG 1 cut(s) 173
SmlI CTYRAG 2 cut(s) 184, 297
SmoI CTYRAG 2 cut(s) 184, 297
SspMI CTAG 1 cut(s) 258
StyD4I CCNGG 1 cut(s) 219
TfiI GAWTC 1 cut(s) 190
Tru1I TTAA 2 cut(s) 102, 266
Tru9I TTAA 2 cut(s) 102, 266
TscAI CASTG 1 cut(s) 247
TseI GCWGC 1 cut(s) 163
TspDTI ATGAA 3 cut(s) 169, 202, 351
TspRI CASTG 1 cut(s) 247
Van91I CCANNNNNTGG 1 cut(s) 96
XceI RCATGY 1 cut(s) 96
XspI CTAG 1 cut(s) 258
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.