Rh3AG060500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3A
Physical Location & Seq
Reverse (-)
4192660 .. 4195626
2967 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3AG060500.1

Sequence Viewer

Length: 273 bp
ATGCTCATCTTGTTCATCCCAAAGAACCAGGTTATAGGCCTTCTGTTGATTATCTTGGCCATCTCAGGCTTCCACTATGAAGTTTCAGGAGCTAGATGGTTAAGCGAAAACTACGAAAAGGTGGAAGATAATTCAGTGAATGCTCAAGTTCTGCTGAACAGCTCCAACTCAACTGGGGATGGAGGATTTTTCGCCACCAGTAACAGACAAGTGCCTTCTGCTCCTGACCCATTGCACAATAGATCATTGAACACCCTTCTGCCATTGGAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.87

Weight (kDa)

5.17

Isoelectric Point (pI)

42.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0018452)

Species Orthologous Gene IDs
fragaria_vesca FvH4_6g05720
malus_domestica MD04G1206200.v1.1
prunus_persica Prupe.6G326900_v2.0.a1
pyrus_communis pycom04g18240 pycom12g20560
rosa_chinensis RchiOBHm_Chr3g0454611
rosa_roxburghii Rroxscaffold_6G00424930
rosa_rugosa Rorug03G0000600
rosa_samantha Rh3AG060500 Rh3DG062200

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 57
AgsI TTSAA 1 cut(s) 250
AjnI CCWGG 1 cut(s) 27
AluBI AGCT 2 cut(s) 92, 162
AluI AGCT 2 cut(s) 92, 162
AoxI GGCC 2 cut(s) 37, 57
BalI TGGCCA 1 cut(s) 59
BccI CCATC 3 cut(s) 68, 90, 173
BciT130I CCWGG 1 cut(s) 29
BfaI CTAG 1 cut(s) 93
Bme1390I CCNGG 1 cut(s) 29
BmrFI CCNGG 1 cut(s) 29
BmrI ACTGGG 1 cut(s) 183
BmuI ACTGGG 1 cut(s) 183
BpuEI CTTGAG 1 cut(s) 129
Bse1I ACTGG 2 cut(s) 178, 198
Bse3DI GCAATG 1 cut(s) 230
BseBI CCWGG 1 cut(s) 29
BseGI GGATG 2 cut(s) 15, 184
BseMI GCAATG 1 cut(s) 230
BseMII CTCAG 1 cut(s) 78
BseNI ACTGG 2 cut(s) 178, 198
BshFI GGCC 2 cut(s) 39, 59
BsmI GAATGC 1 cut(s) 145
BsnI GGCC 2 cut(s) 39, 59
Bsp143I GATC 1 cut(s) 242
BspANI GGCC 2 cut(s) 39, 59
BspCNI CTCAG 1 cut(s) 77
BsrDI GCAATG 1 cut(s) 230
BsrI ACTGG 2 cut(s) 178, 198
BssMI GATC 1 cut(s) 242
Bst2UI CCWGG 1 cut(s) 29
BstDEI CTNAG 1 cut(s) 64
BstF5I GGATG 2 cut(s) 15, 184
BstKTI GATC 1 cut(s) 245
BstMBI GATC 1 cut(s) 242
BstNI CCWGG 1 cut(s) 29
BstSCI CCNGG 1 cut(s) 27
BsuRI GGCC 2 cut(s) 39, 59
BtsCI GGATG 2 cut(s) 15, 184
BtsIMutI CAGTG 1 cut(s) 141
CsiI ACCWGGT 1 cut(s) 27
CviJI RGCY 5 cut(s) 39, 59, 69, 92, 162
CviKI_1 RGCY 5 cut(s) 39, 59, 69, 92, 162
DdeI CTNAG 1 cut(s) 64
DpnI GATC 1 cut(s) 244
DpnII GATC 1 cut(s) 242
EaeI YGGCCR 1 cut(s) 57
Eco147I AGGCCT 1 cut(s) 39
EcoRII CCWGG 1 cut(s) 27
FaiI YATR 2 cut(s) 35, 78
FokI GGATG 2 cut(s) 2, 191
FspBI CTAG 1 cut(s) 93
HaeIII GGCC 2 cut(s) 39, 59
Hpy188III TCNNGA 2 cut(s) 87, 224
HpyAV CCTTC 3 cut(s) 50, 225, 266
HpyCH4V TGCA 1 cut(s) 235
HpyF3I CTNAG 1 cut(s) 64
Kzo9I GATC 1 cut(s) 242
LmnI GCTCC 3 cut(s) 89, 167, 226
LpnPI CCDG 7 cut(s) 14, 41, 51, 72, 159, 211, 237
MabI ACCWGGT 1 cut(s) 27
MaeI CTAG 1 cut(s) 93
MaeIII GTNAC 1 cut(s) 200
MalI GATC 1 cut(s) 244
MboI GATC 1 cut(s) 242
MboII GAAGA 1 cut(s) 137
MlsI TGGCCA 1 cut(s) 59
MluCI AATT 1 cut(s) 130
MluNI TGGCCA 1 cut(s) 59
MmeI TCCRAC 1 cut(s) 189
MnlI CCTC 1 cut(s) 176
Mox20I TGGCCA 1 cut(s) 59
MscI TGGCCA 1 cut(s) 59
MseI TTAA 1 cut(s) 101
Msp20I TGGCCA 1 cut(s) 59
MspR9I CCNGG 1 cut(s) 29
Mva1269I GAATGC 1 cut(s) 145
MvaI CCWGG 1 cut(s) 29
NdeII GATC 1 cut(s) 242
PceI AGGCCT 1 cut(s) 39
PctI GAATGC 1 cut(s) 145
Psp6I CCWGG 1 cut(s) 27
PspGI CCWGG 1 cut(s) 27
SaqAI TTAA 1 cut(s) 101
Sau3AI GATC 1 cut(s) 242
ScrFI CCNGG 1 cut(s) 29
SetI ASST 4 cut(s) 33, 94, 123, 164
SexAI ACCWGGT 1 cut(s) 27
SmlI CTYRAG 1 cut(s) 144
SmoI CTYRAG 1 cut(s) 144
Sse9I AATT 1 cut(s) 130
SseBI AGGCCT 1 cut(s) 39
SspMI CTAG 1 cut(s) 93
StuI AGGCCT 1 cut(s) 39
StyD4I CCNGG 1 cut(s) 27
TasI AATT 1 cut(s) 130
Tru1I TTAA 1 cut(s) 101
Tru9I TTAA 1 cut(s) 101
TscAI CASTG 1 cut(s) 141
TspDTI ATGAA 2 cut(s) 4, 93
TspRI CASTG 1 cut(s) 141
XspI CTAG 1 cut(s) 93
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.