Prupe.7G174100_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp07
Physical Location & Seq
Reverse (-)
17408472 .. 17409371
900 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.7G174100.1

Sequence Viewer

Length: 414 bp
ATGCACCATTTAGGTGTGAAGAAAAGCAATCTTCTTGATTTGGCTTCTGCAGAGACAAACAAGCTTGGCTCTACAGGCAAACATGACCAGCCTCTCTGCCCCAAGCCTCGTAGAGCTGGCCCTGCCATACCTGAATTCCTCAAGCCTCAAAGATGTAACAAGCACAGCCAACAAAATTCTGATGAAAGAAGCGGAATTCTGAATATGATCACTGAAAAGGAAATATTTGATGGGAGAGAACATGTATGCACCAAGTGTTCACCAGCATGTTACTCAGGATCTCCACCAGGCAGAACAAATAACCCTCTGGTTCATGATGTGCAGTTTCTTCATCAGATGGAACTTCTTTCTCCATTCACAAGAACAAAGCTCTCAGATAAATTTGGTTTTAGTACCTCTGCCTCTCCACTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

138

Amino Acids

15.17

Weight (kDa)

9.08

Isoelectric Point (pI)

52.49

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017217)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g11180
malus_domestica MD02G1124300.v1.1 MD15G1238300.v1.1
prunus_persica Prupe.7G174100_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0098471
rosa_laevigata RLG00000016802
rosa_roxburghii Rroxscaffold_2G00143930
rosa_rugosa Rorug02G0073500
rosa_samantha Rh2AG120800 Rh2BG123600 Rh2CG125200 Rh2DG125800
rosa_wichuraiana Rw2G009470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 192
AclWI GGATC 1 cut(s) 286
AcsI RAATTY 4 cut(s) 134, 175, 195, 380
AdeI CACNNNGTG 1 cut(s) 255
AfaI GTAC 1 cut(s) 394
AflIII ACRYGT 1 cut(s) 241
AjnI CCWGG 1 cut(s) 286
AluBI AGCT 3 cut(s) 64, 116, 370
AluI AGCT 3 cut(s) 64, 116, 370
Alw26I GTCTC 1 cut(s) 47
AlwI GGATC 1 cut(s) 286
AoxI GGCC 1 cut(s) 118
ApoI RAATTY 4 cut(s) 134, 175, 195, 380
AspS9I GGNCC 1 cut(s) 119
AsuHPI GGTGA 1 cut(s) 252
BccI CCATC 2 cut(s) 224, 331
BciT130I CCWGG 1 cut(s) 288
BclI TGATCA 1 cut(s) 207
BcoDI GTCTC 1 cut(s) 47
BfmI CTRYAG 2 cut(s) 48, 72
Bme1390I CCNGG 1 cut(s) 288
BmgT120I GGNCC 1 cut(s) 119
BmrFI CCNGG 1 cut(s) 288
BpuEI CTTGAG 1 cut(s) 125
BseBI CCWGG 1 cut(s) 288
BseMII CTCAG 2 cut(s) 288, 387
BsgI GTGCAG 1 cut(s) 341
BshFI GGCC 1 cut(s) 120
BsmAI GTCTC 1 cut(s) 47
BsnI GGCC 1 cut(s) 120
Bsp143I GATC 2 cut(s) 207, 278
BspACI CCGC 1 cut(s) 192
BspANI GGCC 1 cut(s) 120
BspCNI CTCAG 2 cut(s) 287, 386
BspHI TCATGA 1 cut(s) 313
BspMAI CTGCAG 1 cut(s) 52
BspPI GGATC 1 cut(s) 286
BssMI GATC 2 cut(s) 207, 278
Bst2UI CCWGG 1 cut(s) 288
Bst4CI ACNGT 1 cut(s) 411
BstC8I GCNNGC 1 cut(s) 118
BstDEI CTNAG 2 cut(s) 274, 373
BstKTI GATC 2 cut(s) 210, 281
BstMAI GTCTC 1 cut(s) 47
BstMBI GATC 2 cut(s) 207, 278
BstMWI GCNNNNNNNGC 2 cut(s) 75, 122
BstNI CCWGG 1 cut(s) 288
BstNSI RCATGY 2 cut(s) 245, 270
BstSCI CCNGG 1 cut(s) 286
BstSFI CTRYAG 2 cut(s) 48, 72
BstX2I RGATCY 1 cut(s) 278
BstYI RGATCY 1 cut(s) 278
BsuRI GGCC 1 cut(s) 120
BtsIMutI CAGTG 2 cut(s) 210, 407
Cac8I GCNNGC 1 cut(s) 118
CciI TCATGA 1 cut(s) 313
Cfr13I GGNCC 1 cut(s) 119
Csp6I GTAC 1 cut(s) 393
CviAII CATG 4 cut(s) 83, 242, 267, 314
CviQI GTAC 1 cut(s) 393
DdeI CTNAG 2 cut(s) 274, 373
DpnI GATC 2 cut(s) 209, 280
DpnII GATC 2 cut(s) 207, 278
DraIII CACNNNGTG 1 cut(s) 255
EcoRI GAATTC 2 cut(s) 134, 195
EcoRII CCWGG 1 cut(s) 286
FaeI CATG 4 cut(s) 86, 245, 270, 317
FaiI YATR 7 cut(s) 84, 128, 206, 243, 247, 268, 315
FatI CATG 4 cut(s) 82, 241, 266, 313
FbaI TGATCA 1 cut(s) 207
HaeIII GGCC 1 cut(s) 120
Hin1II CATG 4 cut(s) 86, 245, 270, 317
HindIII AAGCTT 1 cut(s) 62
HphI GGTGA 1 cut(s) 252
Hpy166II GTNNAC 1 cut(s) 260
Hpy188I TCNGA 4 cut(s) 181, 201, 336, 376
Hpy188III TCNNGA 3 cut(s) 35, 276, 314
Hpy8I GTNNAC 1 cut(s) 260
HpyCH4III ACNGT 1 cut(s) 411
HpyCH4V TGCA 4 cut(s) 4, 50, 249, 322
HpyF10VI GCNNNNNNNGC 2 cut(s) 75, 122
HpyF3I CTNAG 2 cut(s) 274, 373
Hsp92II CATG 4 cut(s) 86, 245, 270, 317
Ksp22I TGATCA 1 cut(s) 207
Kzo9I GATC 2 cut(s) 207, 278
MaeIII GTNAC 2 cut(s) 155, 269
MalI GATC 2 cut(s) 209, 280
MboI GATC 2 cut(s) 207, 278
MboII GAAGA 3 cut(s) 23, 31, 320
MflI RGATCY 1 cut(s) 278
MluCI AATT 4 cut(s) 134, 175, 195, 380
MnlI CCTC 7 cut(s) 102, 117, 149, 156, 315, 406, 412
MslI CAYNNNNRTG 2 cut(s) 12, 265
MspR9I CCNGG 1 cut(s) 288
MvaI CCWGG 1 cut(s) 288
MwoI GCNNNNNNNGC 2 cut(s) 75, 122
NdeII GATC 2 cut(s) 207, 278
NlaIII CATG 4 cut(s) 86, 245, 270, 317
NspI RCATGY 2 cut(s) 245, 270
PagI TCATGA 1 cut(s) 313
PciI ACATGT 1 cut(s) 241
PscI ACATGT 1 cut(s) 241
Psp6I CCWGG 1 cut(s) 286
PspGI CCWGG 1 cut(s) 286
PspPI GGNCC 1 cut(s) 119
PstI CTGCAG 1 cut(s) 52
PsuI RGATCY 1 cut(s) 278
RsaI GTAC 1 cut(s) 394
RsaNI GTAC 1 cut(s) 393
RseI CAYNNNNRTG 2 cut(s) 12, 265
Sau3AI GATC 2 cut(s) 207, 278
Sau96I GGNCC 1 cut(s) 119
ScrFI CCNGG 1 cut(s) 288
SetI ASST 6 cut(s) 16, 66, 118, 133, 372, 398
SfcI CTRYAG 2 cut(s) 48, 72
SmiMI CAYNNNNRTG 2 cut(s) 12, 265
SmlI CTYRAG 1 cut(s) 140
SmoI CTYRAG 1 cut(s) 140
Sse9I AATT 4 cut(s) 134, 175, 195, 380
SsiI CCGC 1 cut(s) 192
SspI AATATT 1 cut(s) 225
StyD4I CCNGG 1 cut(s) 286
TaaI ACNGT 1 cut(s) 411
TasI AATT 4 cut(s) 134, 175, 195, 380
TscAI CASTG 2 cut(s) 217, 414
TspDTI ATGAA 3 cut(s) 198, 302, 320
TspRI CASTG 2 cut(s) 217, 414
XapI RAATTY 4 cut(s) 134, 175, 195, 380
XceI RCATGY 2 cut(s) 245, 270
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.