Rorug02G0073500

No description available

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000002
Physical Location & Seq
Reverse (-)
5863781 .. 5864463
683 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug02G0073500.1

Sequence Viewer

Length: 276 bp
ATGAACTATGAACAACAGGAGGTTCATGAGAGCGCTGAAGTTTCAGATATAGTTAAAGCATACATAAAATTGCTCGAAGAGAGGCAGATGTCAAATGTTAGGAAATTTCTCTTGGCAGTTCATTGGGTTAAAGGTGCTGCACACTTTTTTGTTGGGGATGAAATCCTCGACACTGAGGCGCTTGACGTGACTTCAGAGTTGGATGGGAGATACAGTGCCTTAATAGAGGTCCAGGTTTGTGATCGGGTGGTGACAGAGCAGCGGCCACTTCAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

91

Amino Acids

10.48

Weight (kDa)

4.7

Isoelectric Point (pI)

37.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017217)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g11180
malus_domestica MD02G1124300.v1.1 MD15G1238300.v1.1
prunus_persica Prupe.7G174100_v2.0.a1
rosa_chinensis RchiOBHm_Chr2g0098471
rosa_laevigata RLG00000016802
rosa_roxburghii Rroxscaffold_2G00143930
rosa_rugosa Rorug02G0073500
rosa_samantha Rh2AG120800 Rh2BG123600 Rh2CG125200 Rh2DG125800
rosa_wichuraiana Rw2G009470

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 262
AcoI YGGCCR 1 cut(s) 263
AcsI RAATTY 1 cut(s) 104
AcuI CTGAAG 3 cut(s) 57, 177, 254
AfeI AGCGCT 1 cut(s) 34
AjiI CACGTC 1 cut(s) 187
AjnI CCWGG 1 cut(s) 231
AjuI GAANNNNNNNTTGG 2 cut(s) 95, 127
Aor51HI AGCGCT 1 cut(s) 34
AoxI GGCC 1 cut(s) 263
ApeKI GCWGC 2 cut(s) 137, 259
ApoI RAATTY 1 cut(s) 104
AspLEI GCGC 2 cut(s) 35, 181
AspS9I GGNCC 1 cut(s) 229
AsuHPI GGTGA 1 cut(s) 262
AvaII GGWCC 1 cut(s) 229
BbvI GCAGC 2 cut(s) 124, 271
BccI CCATC 1 cut(s) 197
BciT130I CCWGG 1 cut(s) 233
BfoI RGCGCY 2 cut(s) 36, 182
BisI GCNGC 3 cut(s) 138, 260, 263
BlsI GCNGC 3 cut(s) 139, 261, 264
Bme1390I CCNGG 1 cut(s) 233
Bme18I GGWCC 1 cut(s) 229
BmgBI CACGTC 1 cut(s) 187
BmgT120I GGNCC 1 cut(s) 229
BmrFI CCNGG 1 cut(s) 233
BsaXI ACNNNNNCTCC 2 cut(s) 199, 229
BseBI CCWGG 1 cut(s) 233
BseGI GGATG 2 cut(s) 163, 208
BseMII CTCAG 1 cut(s) 165
BseXI GCAGC 2 cut(s) 124, 271
BsgI GTGCAG 1 cut(s) 123
BshFI GGCC 1 cut(s) 265
BsnI GGCC 1 cut(s) 265
Bsp143I GATC 1 cut(s) 241
BspACI CCGC 1 cut(s) 262
BspANI GGCC 1 cut(s) 265
BspCNI CTCAG 1 cut(s) 166
BspHI TCATGA 1 cut(s) 25
BssMI GATC 1 cut(s) 241
Bst2UI CCWGG 1 cut(s) 233
Bst4CI ACNGT 1 cut(s) 215
Bst6I CTCTTC 1 cut(s) 72
BstDEI CTNAG 1 cut(s) 174
BstF5I GGATG 2 cut(s) 163, 208
BstH2I RGCGCY 2 cut(s) 36, 182
BstHHI GCGC 2 cut(s) 35, 181
BstKTI GATC 1 cut(s) 244
BstMBI GATC 1 cut(s) 241
BstNI CCWGG 1 cut(s) 233
BstSCI CCNGG 1 cut(s) 231
BstV1I GCAGC 2 cut(s) 124, 271
BsuRI GGCC 1 cut(s) 265
BtrI CACGTC 1 cut(s) 187
BtsCI GGATG 2 cut(s) 163, 208
BtsIMutI CAGTG 2 cut(s) 171, 220
CciI TCATGA 1 cut(s) 25
CfoI GCGC 2 cut(s) 35, 181
Cfr13I GGNCC 1 cut(s) 229
CviAII CATG 1 cut(s) 26
CviJI RGCY 1 cut(s) 265
CviKI_1 RGCY 1 cut(s) 265
DdeI CTNAG 1 cut(s) 174
DpnI GATC 1 cut(s) 243
DpnII GATC 1 cut(s) 241
EaeI YGGCCR 1 cut(s) 263
Eam1104I CTCTTC 1 cut(s) 72
EarI CTCTTC 1 cut(s) 72
Eco47I GGWCC 1 cut(s) 229
Eco47III AGCGCT 1 cut(s) 34
Eco57I CTGAAG 3 cut(s) 57, 177, 254
EcoRII CCWGG 1 cut(s) 231
FaeI CATG 1 cut(s) 29
FaiI YATR 5 cut(s) 9, 27, 50, 61, 65
FatI CATG 1 cut(s) 25
Fnu4HI GCNGC 3 cut(s) 138, 260, 263
FokI GGATG 2 cut(s) 170, 215
Fsp4HI GCNGC 3 cut(s) 138, 260, 263
GlaI GCGC 2 cut(s) 34, 180
GluI GCNGC 3 cut(s) 138, 260, 263
HaeII RGCGCY 2 cut(s) 36, 182
HaeIII GGCC 1 cut(s) 265
HhaI GCGC 2 cut(s) 35, 181
Hin1II CATG 1 cut(s) 29
Hin6I GCGC 2 cut(s) 33, 179
HinP1I GCGC 2 cut(s) 33, 179
HphI GGTGA 1 cut(s) 262
Hpy188I TCNGA 2 cut(s) 46, 196
Hpy188III TCNNGA 1 cut(s) 26
HpyCH4III ACNGT 1 cut(s) 215
HpyCH4IV ACGT 1 cut(s) 186
HpyCH4V TGCA 1 cut(s) 140
HpyF3I CTNAG 1 cut(s) 174
HpySE526I ACGT 1 cut(s) 186
Hsp92II CATG 1 cut(s) 29
HspAI GCGC 2 cut(s) 33, 179
Kzo9I GATC 1 cut(s) 241
LpnPI CCDG 3 cut(s) 2, 218, 245
Lsp1109I GCAGC 2 cut(s) 124, 271
MaeII ACGT 1 cut(s) 186
MaeIII GTNAC 2 cut(s) 187, 250
MalI GATC 1 cut(s) 243
MboI GATC 1 cut(s) 241
MboII GAAGA 1 cut(s) 89
MluCI AATT 2 cut(s) 68, 104
MmeI TCCRAC 1 cut(s) 180
MnlI CCTC 5 cut(s) 13, 75, 169, 176, 220
MseI TTAA 3 cut(s) 54, 129, 221
MspA1I CMGCKG 1 cut(s) 262
MspR9I CCNGG 1 cut(s) 233
MvaI CCWGG 1 cut(s) 233
NdeII GATC 1 cut(s) 241
NlaIII CATG 1 cut(s) 29
NmuCI GTSAC 2 cut(s) 187, 250
PagI TCATGA 1 cut(s) 25
PkrI GCNGC 3 cut(s) 139, 261, 264
Psp6I CCWGG 1 cut(s) 231
PspGI CCWGG 1 cut(s) 231
PspPI GGNCC 1 cut(s) 229
SaqAI TTAA 3 cut(s) 54, 129, 221
SatI GCNGC 3 cut(s) 138, 260, 263
Sau3AI GATC 1 cut(s) 241
Sau96I GGNCC 1 cut(s) 229
ScrFI CCNGG 1 cut(s) 233
SetI ASST 5 cut(s) 24, 136, 189, 231, 237
SinI GGWCC 1 cut(s) 229
Sse9I AATT 2 cut(s) 68, 104
SsiI CCGC 1 cut(s) 262
StyD4I CCNGG 1 cut(s) 231
TaaI ACNGT 1 cut(s) 215
TaiI ACGT 1 cut(s) 189
TaqI TCGA 2 cut(s) 75, 168
TasI AATT 2 cut(s) 68, 104
TauI GCSGC 1 cut(s) 265
Tru1I TTAA 3 cut(s) 54, 129, 221
Tru9I TTAA 3 cut(s) 54, 129, 221
TscAI CASTG 2 cut(s) 178, 220
TseFI GTSAC 2 cut(s) 187, 250
TseI GCWGC 2 cut(s) 137, 259
Tsp45I GTSAC 2 cut(s) 187, 250
TspDTI ATGAA 5 cut(s) 14, 17, 24, 110, 174
TspRI CASTG 2 cut(s) 178, 220
VpaK11BI GGWCC 1 cut(s) 229
XapI RAATTY 1 cut(s) 104
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.