Prupe.8G075700_v2.0.a1

Cysteine-rich TM module stress tolerance

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
11008965 .. 11010794
1830 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G075700.1

Sequence Viewer

Length: 204 bp
ATGAGTGATCCCAAGTATGGTTACGCTGATCCACCTCAAGGGCCTTATCAAGGACCTCCTGTGATGGCTCCTCCTCAATATTATGCTGCTGCTCCACCACCAAAAAGAGAACCAGGTTTCCTTGAAGGATGCTTTGCAGCATTATGTTGCTGTTGTCTCCTGGATGAGTGTTGCTGCGACCCCTCAATTTTATTTGTTACCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.21

Weight (kDa)

4.14

Isoelectric Point (pI)

75.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017581)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18950
malus_domestica MD10G1057100.v1.1
prunus_persica Prupe.8G075700_v2.0.a1
pyrus_communis pycom10g04400
rosa_chinensis RchiOBHm_Chr2g0109971
rosa_multiflora Rmu_sc0028281.1_g000002
rosa_roxburghii Rroxscaffold_2G00133840
rosa_rugosa Rorug02G0164700
rosa_samantha Rh2AG216300 Rh2CG218500 Rh2DG221900
rosa_wichuraiana Rw2G016710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 2 cut(s) 2, 23
AfiI CCNNNNNNNGG 3 cut(s) 17, 38, 50
AgsI TTSAA 1 cut(s) 125
AjnI CCWGG 2 cut(s) 112, 159
AloI GAACNNNNNNTCC 2 cut(s) 102, 134
Alw26I GTCTC 1 cut(s) 161
AlwI GGATC 2 cut(s) 2, 23
AoxI GGCC 1 cut(s) 41
ApeKI GCWGC 4 cut(s) 86, 89, 137, 174
AspS9I GGNCC 2 cut(s) 41, 53
AvaII GGWCC 1 cut(s) 53
BbvI GCAGC 4 cut(s) 73, 76, 149, 161
BccI CCATC 1 cut(s) 58
BciT130I CCWGG 2 cut(s) 114, 161
BcoDI GTCTC 1 cut(s) 161
BisI GCNGC 4 cut(s) 87, 90, 138, 175
BlsI GCNGC 4 cut(s) 88, 91, 139, 176
Bme1390I CCNGG 2 cut(s) 114, 161
Bme18I GGWCC 1 cut(s) 53
BmgT120I GGNCC 2 cut(s) 41, 53
BmiI GGNNCC 1 cut(s) 69
BmrFI CCNGG 2 cut(s) 114, 161
BmsI GCATC 1 cut(s) 119
BpuEI CTTGAG 1 cut(s) 21
Bsc4I CCNNNNNNNGG 3 cut(s) 17, 38, 50
BseBI CCWGG 2 cut(s) 114, 161
BseGI GGATG 2 cut(s) 134, 169
BseLI CCNNNNNNNGG 3 cut(s) 17, 38, 50
BseRI GAGGAG 2 cut(s) 60, 63
BseXI GCAGC 4 cut(s) 73, 76, 149, 161
BshFI GGCC 1 cut(s) 43
BslI CCNNNNNNNGG 3 cut(s) 17, 38, 50
BsmAI GTCTC 1 cut(s) 161
BsnI GGCC 1 cut(s) 43
Bsp143I GATC 2 cut(s) 7, 28
BspANI GGCC 1 cut(s) 43
BspLI GGNNCC 1 cut(s) 69
BspPI GGATC 2 cut(s) 2, 23
BssMI GATC 2 cut(s) 7, 28
Bst2UI CCWGG 2 cut(s) 114, 161
BstENI CCTNNNNNAGG 1 cut(s) 48
BstF5I GGATG 2 cut(s) 134, 169
BstKTI GATC 2 cut(s) 10, 31
BstMAI GTCTC 1 cut(s) 161
BstMBI GATC 2 cut(s) 7, 28
BstNI CCWGG 2 cut(s) 114, 161
BstSCI CCNGG 2 cut(s) 112, 159
BstV1I GCAGC 4 cut(s) 73, 76, 149, 161
BsuRI GGCC 1 cut(s) 43
BtsCI GGATG 2 cut(s) 134, 169
Cfr13I GGNCC 2 cut(s) 41, 53
CsiI ACCWGGT 1 cut(s) 112
CviJI RGCY 2 cut(s) 43, 68
CviKI_1 RGCY 2 cut(s) 43, 68
DpnI GATC 2 cut(s) 9, 30
DpnII GATC 2 cut(s) 7, 28
Eco47I GGWCC 1 cut(s) 53
EcoNI CCTNNNNNAGG 1 cut(s) 48
EcoO109I RGGNCCY 2 cut(s) 41, 53
EcoRII CCWGG 2 cut(s) 112, 159
FaiI YATR 3 cut(s) 18, 84, 145
Fnu4HI GCNGC 4 cut(s) 87, 90, 138, 175
FokI GGATG 2 cut(s) 141, 176
Fsp4HI GCNGC 4 cut(s) 87, 90, 138, 175
GluI GCNGC 4 cut(s) 87, 90, 138, 175
HaeIII GGCC 1 cut(s) 43
HpyAV CCTTC 1 cut(s) 119
HpyCH4V TGCA 1 cut(s) 137
Kzo9I GATC 2 cut(s) 7, 28
LmnI GCTCC 2 cut(s) 73, 97
LpnPI CCDG 5 cut(s) 72, 99, 126, 146, 173
Lsp1109I GCAGC 4 cut(s) 73, 76, 149, 161
LweI GCATC 1 cut(s) 119
MabI ACCWGGT 1 cut(s) 112
MaeIII GTNAC 2 cut(s) 20, 196
MalI GATC 2 cut(s) 9, 30
MboI GATC 2 cut(s) 7, 28
MluCI AATT 1 cut(s) 186
MnlI CCTC 5 cut(s) 45, 66, 81, 84, 193
MspR9I CCNGG 2 cut(s) 114, 161
MvaI CCWGG 2 cut(s) 114, 161
NdeII GATC 2 cut(s) 7, 28
NlaIV GGNNCC 1 cut(s) 69
PfoI TCCNGGA 1 cut(s) 159
PkrI GCNGC 4 cut(s) 88, 91, 139, 176
PpuMI RGGWCCY 1 cut(s) 53
Psp5II RGGWCCY 1 cut(s) 53
Psp6I CCWGG 2 cut(s) 112, 159
PspGI CCWGG 2 cut(s) 112, 159
PspN4I GGNNCC 1 cut(s) 69
PspPI GGNCC 2 cut(s) 41, 53
PspPPI RGGWCCY 1 cut(s) 53
SatI GCNGC 4 cut(s) 87, 90, 138, 175
Sau3AI GATC 2 cut(s) 7, 28
Sau96I GGNCC 2 cut(s) 41, 53
ScrFI CCNGG 2 cut(s) 114, 161
SetI ASST 4 cut(s) 37, 58, 118, 203
SexAI ACCWGGT 1 cut(s) 112
SfaNI GCATC 1 cut(s) 119
SgeI CNNG 9 cut(s) 25, 50, 62, 71, 125, 126, 134, 172, 173
SinI GGWCC 1 cut(s) 53
SmlI CTYRAG 1 cut(s) 36
SmoI CTYRAG 1 cut(s) 36
Sse9I AATT 1 cut(s) 186
SspI AATATT 1 cut(s) 80
StyD4I CCNGG 2 cut(s) 112, 159
TasI AATT 1 cut(s) 186
TseI GCWGC 4 cut(s) 86, 89, 137, 174
VpaK11BI GGWCC 1 cut(s) 53
XagI CCTNNNNNAGG 1 cut(s) 48
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.