Rmu_sc0028281.1_g000002

Cysteine-rich TM module stress tolerance

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028281.1
Physical Location & Seq
Forward (+)
11803 .. 12798
996 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028281.1_g000002.1.cds

Sequence Viewer

Length: 207 bp
atgagcgacccaaaatacggttatccctaccctgctcaaggccaaggttattatcaaggccctccagtaatggcacctccacagtatgcttatgctccaccacccaggagagaaccaggtttcctagagggatgccttgcagctttgtgttgctgctgccttgttgacgagtgttgctgcgacccctccgtcctcttcatcatctga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

68

Amino Acids

7.43

Weight (kDa)

4.3

Isoelectric Point (pI)

76.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017581)

Species Orthologous Gene IDs
fragaria_vesca FvH4_1g18950
malus_domestica MD10G1057100.v1.1
prunus_persica Prupe.8G075700_v2.0.a1
pyrus_communis pycom10g04400
rosa_chinensis RchiOBHm_Chr2g0109971
rosa_multiflora Rmu_sc0028281.1_g000002
rosa_roxburghii Rroxscaffold_2G00133840
rosa_rugosa Rorug02G0164700
rosa_samantha Rh2AG216300 Rh2CG218500 Rh2DG221900
rosa_wichuraiana Rw2G016710

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 188
AccB1I GGYRCC 1 cut(s) 73
AfiI CCNNNNNNNGG 2 cut(s) 17, 38
AjnI CCWGG 2 cut(s) 104, 115
AloI GAACNNNNNNTCC 2 cut(s) 105, 137
AluBI AGCT 1 cut(s) 143
AluI AGCT 1 cut(s) 143
AoxI GGCC 2 cut(s) 40, 58
ApeKI GCWGC 4 cut(s) 140, 153, 156, 177
AspS9I GGNCC 1 cut(s) 59
BanI GGYRCC 1 cut(s) 73
BbvI GCAGC 4 cut(s) 140, 143, 152, 164
BciT130I CCWGG 2 cut(s) 106, 117
BfaI CTAG 1 cut(s) 125
BisI GCNGC 4 cut(s) 141, 154, 157, 178
BlsI GCNGC 4 cut(s) 142, 155, 158, 179
Bme1390I CCNGG 2 cut(s) 106, 117
BmgT120I GGNCC 1 cut(s) 59
BmiI GGNNCC 1 cut(s) 75
BmrFI CCNGG 2 cut(s) 106, 117
BmsI GCATC 1 cut(s) 122
BpmI CTGGAG 1 cut(s) 48
BpuEI CTTGAG 1 cut(s) 21
BsaJI CCNNGG 2 cut(s) 43, 104
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 38
Bse1I ACTGG 1 cut(s) 65
BseBI CCWGG 2 cut(s) 106, 117
BseDI CCNNGG 2 cut(s) 43, 104
BseGI GGATG 1 cut(s) 137
BseLI CCNNNNNNNGG 2 cut(s) 17, 38
BseNI ACTGG 1 cut(s) 65
BseXI GCAGC 4 cut(s) 140, 143, 152, 164
BshFI GGCC 2 cut(s) 42, 60
BshNI GGYRCC 1 cut(s) 73
BslI CCNNNNNNNGG 2 cut(s) 17, 38
BsnI GGCC 2 cut(s) 42, 60
BspANI GGCC 2 cut(s) 42, 60
BspLI GGNNCC 1 cut(s) 75
BspT107I GGYRCC 1 cut(s) 73
BsrI ACTGG 1 cut(s) 65
BssECI CCNNGG 2 cut(s) 43, 104
BssT1I CCWWGG 1 cut(s) 43
Bst2UI CCWGG 2 cut(s) 106, 117
Bst4CI ACNGT 2 cut(s) 20, 84
Bst6I CTCTTC 1 cut(s) 200
BstENI CCTNNNNNAGG 1 cut(s) 36
BstF5I GGATG 1 cut(s) 137
BstNI CCWGG 2 cut(s) 106, 117
BstSCI CCNGG 2 cut(s) 104, 115
BstV1I GCAGC 4 cut(s) 140, 143, 152, 164
BsuRI GGCC 2 cut(s) 42, 60
BtsCI GGATG 1 cut(s) 137
Cfr13I GGNCC 1 cut(s) 59
CsiI ACCWGGT 1 cut(s) 115
CviJI RGCY 3 cut(s) 42, 60, 143
CviKI_1 RGCY 3 cut(s) 42, 60, 143
DrdI GACNNNNNNGTC 1 cut(s) 188
DseDI GACNNNNNNGTC 1 cut(s) 188
Eam1104I CTCTTC 1 cut(s) 200
EarI CTCTTC 1 cut(s) 200
Eco130I CCWWGG 1 cut(s) 43
EcoNI CCTNNNNNAGG 1 cut(s) 36
EcoO109I RGGNCCY 1 cut(s) 59
EcoRII CCWGG 2 cut(s) 104, 115
EcoT14I CCWWGG 1 cut(s) 43
ErhI CCWWGG 1 cut(s) 43
FaiI YATR 2 cut(s) 87, 93
Fnu4HI GCNGC 4 cut(s) 141, 154, 157, 178
FokI GGATG 1 cut(s) 144
Fsp4HI GCNGC 4 cut(s) 141, 154, 157, 178
FspBI CTAG 1 cut(s) 125
GluI GCNGC 4 cut(s) 141, 154, 157, 178
GsuI CTGGAG 1 cut(s) 48
HaeIII GGCC 2 cut(s) 42, 60
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
Hpy166II GTNNAC 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 206
Hpy8I GTNNAC 1 cut(s) 166
HpyCH4III ACNGT 2 cut(s) 20, 84
HpyCH4V TGCA 1 cut(s) 140
LmnI GCTCC 1 cut(s) 100
LpnPI CCDG 6 cut(s) 45, 78, 91, 102, 118, 129
Lsp1109I GCAGC 4 cut(s) 140, 143, 152, 164
LweI GCATC 1 cut(s) 122
MabI ACCWGGT 1 cut(s) 115
MaeI CTAG 1 cut(s) 125
MboII GAAGA 1 cut(s) 187
MnlI CCTC 5 cut(s) 72, 87, 121, 196, 203
MspR9I CCNGG 2 cut(s) 106, 117
MvaI CCWGG 2 cut(s) 106, 117
NlaIV GGNNCC 1 cut(s) 75
PkrI GCNGC 4 cut(s) 142, 155, 158, 179
Psp6I CCWGG 2 cut(s) 104, 115
PspGI CCWGG 2 cut(s) 104, 115
PspN4I GGNNCC 1 cut(s) 75
PspPI GGNCC 1 cut(s) 59
SatI GCNGC 4 cut(s) 141, 154, 157, 178
Sau96I GGNCC 1 cut(s) 59
ScrFI CCNGG 2 cut(s) 106, 117
SetI ASST 4 cut(s) 49, 79, 121, 145
SexAI ACCWGGT 1 cut(s) 115
SfaNI GCATC 1 cut(s) 122
SmlI CTYRAG 1 cut(s) 36
SmoI CTYRAG 1 cut(s) 36
SspMI CTAG 1 cut(s) 125
StyD4I CCNGG 2 cut(s) 104, 115
StyI CCWWGG 1 cut(s) 43
TaaI ACNGT 2 cut(s) 20, 84
TseI GCWGC 4 cut(s) 140, 153, 156, 177
TspDTI ATGAA 1 cut(s) 187
TspGWI ACGGA 1 cut(s) 178
XagI CCTNNNNNAGG 1 cut(s) 36
XspI CTAG 1 cut(s) 125
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.