Prupe.8G118600_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
14553958 .. 14554170
213 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G118600.1

Sequence Viewer

Length: 213 bp
ATGTGCTCTTCAGAAGGTGATTGCAGGCCTCTGGGCTTTCTGCTCGGCCTTCCTTTTGCTCTCCTCTCCCTCGTCCTCTCCATCGTCGGCATCGTTATCTGGATCGTCGGATTGTTGCTGACTTGCATATGCCCGTGCTGTTTGTGCGTGACGGTGGTCGTGGAGTTGGCTCTGGAGTTGGGCGAGTGGTTCACTTCTCAAATCCCCTGCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.49

Weight (kDa)

4.05

Isoelectric Point (pI)

16.51

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0014990)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 110
Alw21I GWGCWC 1 cut(s) 8
AlwI GGATC 1 cut(s) 110
AoxI GGCC 2 cut(s) 26, 46
AsuHPI GGTGA 1 cut(s) 29
Bbv12I GWGCWC 1 cut(s) 8
BccI CCATC 1 cut(s) 89
BmsI GCATC 1 cut(s) 99
BoxI GACNNNNGTC 1 cut(s) 155
BpmI CTGGAG 1 cut(s) 194
BseRI GAGGAG 1 cut(s) 53
BshFI GGCC 2 cut(s) 28, 48
BsiHKAI GWGCWC 1 cut(s) 8
BsnI GGCC 2 cut(s) 28, 48
Bsp1286I GDGCHC 1 cut(s) 8
Bsp143I GATC 1 cut(s) 102
BspANI GGCC 2 cut(s) 28, 48
BspPI GGATC 1 cut(s) 110
BspQI GCTCTTC 1 cut(s) 13
BssMI GATC 1 cut(s) 102
Bst4CI ACNGT 1 cut(s) 154
Bst6I CTCTTC 1 cut(s) 13
BstC8I GCNNGC 1 cut(s) 26
BstKTI GATC 1 cut(s) 105
BstMBI GATC 1 cut(s) 102
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstPAI GACNNNNGTC 1 cut(s) 155
BsuRI GGCC 2 cut(s) 28, 48
Cac8I GCNNGC 1 cut(s) 26
CviJI RGCY 4 cut(s) 28, 36, 48, 170
CviKI_1 RGCY 4 cut(s) 28, 36, 48, 170
DpnI GATC 1 cut(s) 104
DpnII GATC 1 cut(s) 102
Eam1104I CTCTTC 1 cut(s) 13
EarI CTCTTC 1 cut(s) 13
Eco147I AGGCCT 1 cut(s) 28
FaiI YATR 2 cut(s) 128, 130
FauNDI CATATG 1 cut(s) 128
GsuI CTGGAG 1 cut(s) 194
HaeIII GGCC 2 cut(s) 28, 48
HphI GGTGA 1 cut(s) 29
Hpy166II GTNNAC 1 cut(s) 192
Hpy188I TCNGA 2 cut(s) 13, 110
Hpy188III TCNNGA 2 cut(s) 100, 173
Hpy8I GTNNAC 1 cut(s) 192
Hpy99I CGWCG 2 cut(s) 89, 110
HpyAV CCTTC 2 cut(s) 8, 59
HpyCH4III ACNGT 1 cut(s) 154
HpyCH4V TGCA 2 cut(s) 24, 126
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
Kzo9I GATC 1 cut(s) 102
LguI GCTCTTC 1 cut(s) 13
LpnPI CCDG 4 cut(s) 10, 17, 85, 158
LweI GCATC 1 cut(s) 99
MaeIII GTNAC 1 cut(s) 148
MalI GATC 1 cut(s) 104
MboI GATC 1 cut(s) 102
MhlI GDGCHC 1 cut(s) 8
MmeI TCCRAC 1 cut(s) 88
MnlI CCTC 4 cut(s) 39, 74, 80, 86
MwoI GCNNNNNNNGC 1 cut(s) 144
NdeI CATATG 1 cut(s) 128
NdeII GATC 1 cut(s) 102
NmeAIII GCCGAG 1 cut(s) 24
NmuCI GTSAC 1 cut(s) 148
PceI AGGCCT 1 cut(s) 28
PciSI GCTCTTC 1 cut(s) 13
PcsI WCGNNNNNNNCGW 1 cut(s) 90
PshAI GACNNNNGTC 1 cut(s) 155
SapI GCTCTTC 1 cut(s) 13
Sau3AI GATC 1 cut(s) 102
SduI GDGCHC 1 cut(s) 8
SetI ASST 1 cut(s) 19
SfaNI GCATC 1 cut(s) 99
SseBI AGGCCT 1 cut(s) 28
StuI AGGCCT 1 cut(s) 28
TaaI ACNGT 1 cut(s) 154
TseFI GTSAC 1 cut(s) 148
Tsp45I GTSAC 1 cut(s) 148
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.