pycom01g09770

Belongs to the helicase family

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Forward (+)
10582769 .. 10583118
350 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g09770.1

Sequence Viewer

Length: 309 bp
ATGTTTTCTTCTTCAAATGAGGAAGCAGATTATGCACCTGATTTCATTTGGATCAAAAGACCAGCAAGTCTTTCTTCTTGTTCCTCAAATCAGAGAGAGCTATCTCTACGCGGTCCCTGCGCGGAGCAACCAGAGGATTTGAGATGGGGTGTAGATGAAGAAGGCGTACGGGTGTATCAGATGGGGTTCCAAGGATCGGGAGGCGTCAGAGGCGCGACGGAGAGTGATGGAGGTGGAGATTGCGGTGAGGGTGTAGGTGGAGATTGTAGAAATAAAAAAATAAAAAAAAAGCCCACGACGTCACGCTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

103

Amino Acids

11.01

Weight (kDa)

5.16

Isoelectric Point (pI)

54.7

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0020409)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 66
AatII GACGTC 1 cut(s) 302
AccII CGCG 3 cut(s) 111, 122, 215
AciI CCGC 3 cut(s) 111, 122, 243
AclWI GGATC 2 cut(s) 59, 202
AcyI GRCGYC 2 cut(s) 204, 299
AfaI GTAC 1 cut(s) 168
AfiI CCNNNNNNNGG 1 cut(s) 196
AgsI TTSAA 1 cut(s) 15
AluBI AGCT 1 cut(s) 100
AluI AGCT 1 cut(s) 100
AlwI GGATC 2 cut(s) 59, 202
AspLEI GCGC 2 cut(s) 122, 215
AspS9I GGNCC 1 cut(s) 113
AsuHPI GGTGA 1 cut(s) 257
AvaII GGWCC 1 cut(s) 113
BaeI ACNNNNGTAYC 2 cut(s) 158, 191
BarI GAAGNNNNNNTAC 2 cut(s) 150, 182
BccI CCATC 3 cut(s) 138, 175, 221
BfaI CTAG 1 cut(s) 307
Bme18I GGWCC 1 cut(s) 113
BmgT120I GGNCC 1 cut(s) 113
BmiI GGNNCC 2 cut(s) 115, 188
BsaHI GRCGYC 2 cut(s) 204, 299
BsaJI CCNNGG 1 cut(s) 190
Bsc4I CCNNNNNNNGG 1 cut(s) 196
BseDI CCNNGG 1 cut(s) 190
BseLI CCNNNNNNNGG 1 cut(s) 196
Bsh1236I CGCG 3 cut(s) 111, 122, 215
BsiWI CGTACG 1 cut(s) 166
BslFI GGGAC 1 cut(s) 99
BslI CCNNNNNNNGG 1 cut(s) 196
BsmFI GGGAC 1 cut(s) 99
Bsp143I GATC 2 cut(s) 51, 194
BspACI CCGC 3 cut(s) 111, 122, 243
BspFNI CGCG 3 cut(s) 111, 122, 215
BspLI GGNNCC 2 cut(s) 115, 188
BspPI GGATC 2 cut(s) 59, 202
BssECI CCNNGG 1 cut(s) 190
BssMI GATC 2 cut(s) 51, 194
BssNI GRCGYC 2 cut(s) 204, 299
BssT1I CCWWGG 1 cut(s) 190
BstACI GRCGYC 2 cut(s) 204, 299
BstAPI GCANNNNNTGC 1 cut(s) 32
BstFNI CGCG 3 cut(s) 111, 122, 215
BstHHI GCGC 2 cut(s) 122, 215
BstKTI GATC 2 cut(s) 54, 197
BstMBI GATC 2 cut(s) 51, 194
BstMWI GCNNNNNNNGC 3 cut(s) 32, 117, 210
BstUI CGCG 3 cut(s) 111, 122, 215
CfoI GCGC 2 cut(s) 122, 215
Cfr13I GGNCC 1 cut(s) 113
CseI GACGC 1 cut(s) 193
Csp6I GTAC 1 cut(s) 167
CviJI RGCY 2 cut(s) 100, 292
CviKI_1 RGCY 2 cut(s) 100, 292
CviQI GTAC 1 cut(s) 167
DpnI GATC 2 cut(s) 53, 196
DpnII GATC 2 cut(s) 51, 194
DrdI GACNNNNNNGTC 1 cut(s) 66
DseDI GACNNNNNNGTC 1 cut(s) 66
Eco130I CCWWGG 1 cut(s) 190
Eco47I GGWCC 1 cut(s) 113
EcoT14I CCWWGG 1 cut(s) 190
ErhI CCWWGG 1 cut(s) 190
FaiI YATR 1 cut(s) 33
FalI AAGNNNNNCTT 2 cut(s) 58, 90
FaqI GGGAC 1 cut(s) 99
FspBI CTAG 1 cut(s) 307
GlaI GCGC 2 cut(s) 121, 214
HgaI GACGC 1 cut(s) 193
HhaI GCGC 2 cut(s) 122, 215
Hin1I GRCGYC 2 cut(s) 204, 299
Hin6I GCGC 2 cut(s) 120, 213
HinP1I GCGC 2 cut(s) 120, 213
HphI GGTGA 1 cut(s) 257
Hpy188I TCNGA 3 cut(s) 93, 180, 209
Hpy188III TCNNGA 1 cut(s) 198
Hpy99I CGWCG 2 cut(s) 220, 301
HpyAV CCTTC 1 cut(s) 155
HpyCH4IV ACGT 1 cut(s) 299
HpyCH4V TGCA 1 cut(s) 35
HpyF10VI GCNNNNNNNGC 3 cut(s) 32, 117, 210
HpySE526I ACGT 1 cut(s) 299
Hsp92I GRCGYC 2 cut(s) 204, 299
HspAI GCGC 2 cut(s) 120, 213
Kzo9I GATC 2 cut(s) 51, 194
LmnI GCTCC 1 cut(s) 124
LpnPI CCDG 4 cut(s) 51, 75, 130, 144
MaeI CTAG 1 cut(s) 307
MaeII ACGT 1 cut(s) 299
MaeIII GTNAC 1 cut(s) 300
MalI GATC 2 cut(s) 53, 196
MboI GATC 2 cut(s) 51, 194
MboII GAAGA 3 cut(s) 3, 66, 170
MnlI CCTC 7 cut(s) 13, 94, 127, 194, 203, 224, 241
MvnI CGCG 3 cut(s) 111, 122, 215
MwoI GCNNNNNNNGC 3 cut(s) 32, 117, 210
NdeII GATC 2 cut(s) 51, 194
NlaIV GGNNCC 2 cut(s) 115, 188
NmuCI GTSAC 1 cut(s) 300
Pfl23II CGTACG 1 cut(s) 166
PspLI CGTACG 1 cut(s) 166
PspN4I GGNNCC 2 cut(s) 115, 188
PspPI GGNCC 1 cut(s) 113
RsaI GTAC 1 cut(s) 168
RsaNI GTAC 1 cut(s) 167
Sau3AI GATC 2 cut(s) 51, 194
Sau96I GGNCC 1 cut(s) 113
SetI ASST 5 cut(s) 40, 102, 235, 259, 302
SinI GGWCC 1 cut(s) 113
SsiI CCGC 3 cut(s) 111, 122, 243
SspMI CTAG 1 cut(s) 307
StyI CCWWGG 1 cut(s) 190
TaiI ACGT 1 cut(s) 302
TseFI GTSAC 1 cut(s) 300
Tsp45I GTSAC 1 cut(s) 300
TspDTI ATGAA 2 cut(s) 34, 171
TspGWI ACGGA 1 cut(s) 233
VpaK11BI GGWCC 1 cut(s) 113
XspI CTAG 1 cut(s) 307
ZraI GACGTC 1 cut(s) 300
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.