pycom01g11770

No description available

Basic Information

Type: gene
Biological Identity
pyrus_communis
Chr1
Physical Location & Seq
Reverse (-)
12811929 .. 12812114
186 bp
Loading structure...
UTR
Exon/CDS
Intron
pycom01g11770.1

Sequence Viewer

Length: 186 bp
ATGGAGGCGTGCAAAGGTTTCCTCGGGCCAGACGGAGATTGGCCCTCGAGTGCAAAGGCAGAAGGGAGCTTGACTGCAAGACCCACCCGTCGAGCAGGGACGAAAGTCGGCCTTAGTGATTCGACGGTGCCGAGTGGAAGGGCCGTCGCTCAACGGATAAAAGTTACTCTAGGGATAACAGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.21

Weight (kDa)

10.02

Isoelectric Point (pI)

31.61

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0019809)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 87
AccB1I GGYRCC 1 cut(s) 127
AluBI AGCT 1 cut(s) 69
AluI AGCT 1 cut(s) 69
Ama87I CYCGRG 2 cut(s) 23, 46
AoxI GGCC 4 cut(s) 26, 41, 109, 141
AspS9I GGNCC 3 cut(s) 26, 42, 141
AvaI CYCGRG 2 cut(s) 23, 46
BanI GGYRCC 1 cut(s) 127
BceAI ACGGC 1 cut(s) 128
BfaI CTAG 1 cut(s) 170
BmeT110I CYCGRG 2 cut(s) 23, 46
BmgT120I GGNCC 3 cut(s) 26, 42, 141
BmiI GGNNCC 1 cut(s) 129
BoxI GACNNNNGTC 1 cut(s) 104
BsaJI CCNNGG 1 cut(s) 22
BseDI CCNNGG 1 cut(s) 22
BshFI GGCC 4 cut(s) 28, 43, 111, 143
BshNI GGYRCC 1 cut(s) 127
BsiHKCI CYCGRG 2 cut(s) 23, 46
BslFI GGGAC 1 cut(s) 112
BsmFI GGGAC 1 cut(s) 112
BsnI GGCC 4 cut(s) 28, 43, 111, 143
BsoBI CYCGRG 2 cut(s) 23, 46
BspANI GGCC 4 cut(s) 28, 43, 111, 143
BspLI GGNNCC 1 cut(s) 129
BspT107I GGYRCC 1 cut(s) 127
BssECI CCNNGG 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 127
BstC8I GCNNGC 1 cut(s) 10
BstDEI CTNAG 1 cut(s) 113
BstPAI GACNNNNGTC 1 cut(s) 104
BsuRI GGCC 4 cut(s) 28, 43, 111, 143
Cac8I GCNNGC 1 cut(s) 10
Cfr13I GGNCC 3 cut(s) 26, 42, 141
CviJI RGCY 6 cut(s) 28, 43, 69, 111, 143, 183
CviKI_1 RGCY 6 cut(s) 28, 43, 69, 111, 143, 183
DdeI CTNAG 1 cut(s) 113
DrdI GACNNNNNNGTC 1 cut(s) 87
DseDI GACNNNNNNGTC 1 cut(s) 87
Eco88I CYCGRG 2 cut(s) 23, 46
FalI AAGNNNNNCTT 2 cut(s) 96, 128
FaqI GGGAC 1 cut(s) 112
FspBI CTAG 1 cut(s) 170
HaeIII GGCC 4 cut(s) 28, 43, 111, 143
HinfI GANTC 1 cut(s) 119
Hpy99I CGWCG 3 cut(s) 93, 127, 149
HpyAV CCTTC 2 cut(s) 56, 132
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4V TGCA 3 cut(s) 12, 53, 77
HpyF3I CTNAG 1 cut(s) 113
LmnI GCTCC 1 cut(s) 66
LpnPI CCDG 3 cut(s) 42, 81, 165
MaeI CTAG 1 cut(s) 170
MaeIII GTNAC 1 cut(s) 163
MnlI CCTC 2 cut(s) 32, 55
NlaIV GGNNCC 1 cut(s) 129
NmeAIII GCCGAG 1 cut(s) 156
PaeR7I CTCGAG 1 cut(s) 46
PcsI WCGNNNNNNNCGW 1 cut(s) 128
PfeI GAWTC 1 cut(s) 119
PshAI GACNNNNGTC 1 cut(s) 104
PspN4I GGNNCC 1 cut(s) 129
PspPI GGNCC 3 cut(s) 26, 42, 141
PspXI VCTCGAGB 1 cut(s) 46
Sau96I GGNCC 3 cut(s) 26, 42, 141
SetI ASST 2 cut(s) 19, 71
Sfr274I CTCGAG 1 cut(s) 46
SlaI CTCGAG 1 cut(s) 46
SmlI CTYRAG 1 cut(s) 46
SmoI CTYRAG 1 cut(s) 46
SspMI CTAG 1 cut(s) 170
TaaI ACNGT 1 cut(s) 127
TaqI TCGA 3 cut(s) 47, 91, 122
TfiI GAWTC 1 cut(s) 119
TspGWI ACGGA 2 cut(s) 48, 169
XcmI CCANNNNNNNNNTGG 1 cut(s) 36
XhoI CTCGAG 1 cut(s) 46
XspI CTAG 1 cut(s) 170
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.